Incidental Mutation 'R7920:Tubgcp5'
ID648291
Institutional Source Beutler Lab
Gene Symbol Tubgcp5
Ensembl Gene ENSMUSG00000033790
Gene Nametubulin, gamma complex associated protein 5
SynonymsB130010C12Rik, GCP5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R7920 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location55794154-55831677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55816562 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 621 (T621A)
Ref Sequence ENSEMBL: ENSMUSP00000032627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206191]
Predicted Effect probably benign
Transcript: ENSMUST00000032627
AA Change: T621A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790
AA Change: T621A

DomainStartEndE-ValueType
low complexity region 109 124 N/A INTRINSIC
Pfam:Spc97_Spc98 273 942 1.2e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205796
AA Change: T621A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206191
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 41,996,173 S9P probably damaging Het
AI661453 A T 17: 47,468,406 Q1019L unknown Het
Aldh1a1 T A 19: 20,617,937 W77R probably damaging Het
Cc2d2a T C 5: 43,739,309 I1516T probably benign Het
Ccdc149 T A 5: 52,405,094 I197F probably damaging Het
Ccdc189 A G 7: 127,587,953 M46T probably benign Het
Cfb A G 17: 34,860,891 V176A probably benign Het
Chordc1 A G 9: 18,302,101 K83E probably benign Het
Cic G A 7: 25,271,959 V372M probably benign Het
Coq2 T A 5: 100,663,875 probably benign Het
Cradd A G 10: 95,322,711 L58P probably damaging Het
Crim1 A T 17: 78,303,064 D316V probably damaging Het
Cyb5rl C A 4: 107,071,008 L114I possibly damaging Het
Cyp2c69 T G 19: 39,877,803 probably null Het
Ddhd1 A G 14: 45,657,470 F181S probably damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dmrt1 T C 19: 25,506,019 S56P possibly damaging Het
Dnah12 A G 14: 26,856,542 E3086G possibly damaging Het
Dnah5 A T 15: 28,453,222 M4380L probably benign Het
Dph7 A T 2: 24,971,612 M346L probably benign Het
Dusp27 T A 1: 166,099,896 N716Y possibly damaging Het
Egf C T 3: 129,735,840 R307H probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fcna T C 2: 25,626,286 K112E probably benign Het
Fkbp5 A T 17: 28,429,239 N125K possibly damaging Het
Foxo3 C T 10: 42,197,769 V251I possibly damaging Het
Fryl T A 5: 73,101,807 probably null Het
Fsip2 A G 2: 82,951,021 E253G possibly damaging Het
Gm49333 A G 16: 20,637,692 E428G possibly damaging Het
Gprc6a T A 10: 51,614,930 T908S probably benign Het
Grin2c A T 11: 115,254,144 F560L probably benign Het
Hao1 T A 2: 134,548,252 N56Y probably damaging Het
Haus3 T C 5: 34,167,702 I204M probably benign Het
Htr3b C A 9: 48,937,156 C263F probably damaging Het
Ica1 A T 6: 8,742,274 C120S probably benign Het
Inpp4a T A 1: 37,367,805 S210T probably benign Het
Inpp5d T G 1: 87,705,949 I699S probably damaging Het
Kcng1 A G 2: 168,262,984 V314A probably benign Het
Lcn11 G A 2: 25,779,331 V167M possibly damaging Het
Lingo3 C A 10: 80,834,548 R516L probably benign Het
Lrmda T C 14: 22,596,478 V151A probably damaging Het
Ly6g5b A C 17: 35,114,602 I133R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mroh7 T C 4: 106,707,576 T562A probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Olfr539 A T 7: 140,667,901 S198C possibly damaging Het
Pkhd1 A T 1: 20,275,535 D2756E probably damaging Het
Plekhm2 T C 4: 141,632,121 D445G probably damaging Het
Ppp1r12c C T 7: 4,483,355 G605D probably benign Het
Pygb T A 2: 150,787,002 N45K possibly damaging Het
Scn4b A G 9: 45,146,771 T54A probably damaging Het
Scrt1 T A 15: 76,519,217 H191L unknown Het
Sdc3 A G 4: 130,819,196 M289V probably benign Het
Shb C T 4: 45,489,054 probably null Het
Slc1a5 A G 7: 16,793,870 T364A probably damaging Het
Slc25a27 A G 17: 43,649,673 V218A probably benign Het
Slc39a4 C T 15: 76,614,085 G384D probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Tmem67 A T 4: 12,089,284 probably null Het
Tonsl C T 15: 76,634,587 R544H probably damaging Het
Trex1 A G 9: 109,058,089 V278A unknown Het
Ttn A T 2: 76,795,157 D15107E probably damaging Het
Zfhx4 T C 3: 5,400,455 V1916A possibly damaging Het
Zfp260 A T 7: 30,105,592 K306* probably null Het
Zkscan7 A T 9: 122,895,909 T648S probably benign Het
Zscan4c T A 7: 11,009,772 F433I possibly damaging Het
Other mutations in Tubgcp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Tubgcp5 APN 7 55806595 missense possibly damaging 0.91
IGL01291:Tubgcp5 APN 7 55808529 missense possibly damaging 0.83
IGL01343:Tubgcp5 APN 7 55796031 splice site probably benign
IGL01597:Tubgcp5 APN 7 55806832 splice site probably benign
IGL01688:Tubgcp5 APN 7 55815018 missense possibly damaging 0.92
IGL01843:Tubgcp5 APN 7 55799473 missense probably benign 0.02
IGL01950:Tubgcp5 APN 7 55806088 missense possibly damaging 0.93
IGL01957:Tubgcp5 APN 7 55818757 missense probably damaging 1.00
IGL02902:Tubgcp5 APN 7 55806607 nonsense probably null
IGL03105:Tubgcp5 APN 7 55825581 missense probably damaging 1.00
ANU05:Tubgcp5 UTSW 7 55808529 missense possibly damaging 0.83
R0078:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R0322:Tubgcp5 UTSW 7 55814978 missense probably damaging 0.98
R0362:Tubgcp5 UTSW 7 55800684 missense probably damaging 1.00
R0449:Tubgcp5 UTSW 7 55823567 missense probably benign
R0488:Tubgcp5 UTSW 7 55829338 missense probably damaging 0.96
R0853:Tubgcp5 UTSW 7 55814851 splice site probably benign
R0885:Tubgcp5 UTSW 7 55806055 nonsense probably null
R1483:Tubgcp5 UTSW 7 55825707 critical splice donor site probably null
R1746:Tubgcp5 UTSW 7 55808537 missense probably benign 0.05
R1766:Tubgcp5 UTSW 7 55815020 missense probably benign 0.15
R2148:Tubgcp5 UTSW 7 55799511 missense probably damaging 1.00
R2229:Tubgcp5 UTSW 7 55830881 missense probably damaging 1.00
R3766:Tubgcp5 UTSW 7 55830866 missense probably damaging 0.98
R4154:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R4838:Tubgcp5 UTSW 7 55794185 unclassified probably benign
R4948:Tubgcp5 UTSW 7 55806123 missense probably benign 0.00
R5110:Tubgcp5 UTSW 7 55808637 missense probably damaging 0.96
R5347:Tubgcp5 UTSW 7 55823685 missense probably damaging 1.00
R5417:Tubgcp5 UTSW 7 55825661 missense possibly damaging 0.90
R5574:Tubgcp5 UTSW 7 55805329 missense probably benign 0.01
R5758:Tubgcp5 UTSW 7 55818895 missense probably damaging 1.00
R5957:Tubgcp5 UTSW 7 55814962 missense probably benign 0.03
R6014:Tubgcp5 UTSW 7 55823609 missense probably benign
R6141:Tubgcp5 UTSW 7 55806778 missense probably benign 0.30
R6289:Tubgcp5 UTSW 7 55795923 missense probably benign 0.05
R6511:Tubgcp5 UTSW 7 55817392 nonsense probably null
R6563:Tubgcp5 UTSW 7 55825661 missense possibly damaging 0.90
R6574:Tubgcp5 UTSW 7 55823583 missense probably benign
R6596:Tubgcp5 UTSW 7 55806634 missense probably benign 0.38
R7016:Tubgcp5 UTSW 7 55794229 missense possibly damaging 0.76
R7038:Tubgcp5 UTSW 7 55805366 missense probably damaging 0.99
R7075:Tubgcp5 UTSW 7 55829407 missense probably benign 0.04
R7083:Tubgcp5 UTSW 7 55800695 nonsense probably null
R7213:Tubgcp5 UTSW 7 55806112 missense probably damaging 0.97
R7284:Tubgcp5 UTSW 7 55823567 missense probably benign
R7600:Tubgcp5 UTSW 7 55808513 missense probably benign
R7813:Tubgcp5 UTSW 7 55800696 missense possibly damaging 0.49
R7948:Tubgcp5 UTSW 7 55794248 missense probably benign 0.01
R8438:Tubgcp5 UTSW 7 55804615 missense possibly damaging 0.67
R8499:Tubgcp5 UTSW 7 55804615 missense possibly damaging 0.67
Z1088:Tubgcp5 UTSW 7 55815101 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACATGTGGGCGAGTGTC -3'
(R):5'- TCTACCTGGCAGAAACAACTACA -3'

Sequencing Primer
(F):5'- GCATTAGATCCTCTGCAGCTGAAG -3'
(R):5'- CAAAGCATTGCGTAGATATTGCCAG -3'
Posted On2020-09-15