Incidental Mutation 'R7920:Or13a25'
ID 648293
Institutional Source Beutler Lab
Gene Symbol Or13a25
Ensembl Gene ENSMUSG00000059136
Gene Name olfactory receptor family 13 subfamily A member 25
Synonyms GA_x6K02T2PBJ9-42813436-42814368, Olfr539, MOR253-4
MMRRC Submission 045967-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R7920 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 140247202-140248161 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 140247814 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 198 (S198C)
Ref Sequence ENSEMBL: ENSMUSP00000151522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078967] [ENSMUST00000218865]
AlphaFold Q8VGL9
Predicted Effect possibly damaging
Transcript: ENSMUST00000078967
AA Change: S205C

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077990
Gene: ENSMUSG00000059136
AA Change: S205C

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 6.5e-50 PFAM
Pfam:7tm_1 50 299 4.9e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000218865
AA Change: S198C

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 41,818,130 (GRCm39) S9P probably damaging Het
AI661453 A T 17: 47,779,331 (GRCm39) Q1019L unknown Het
Aldh1a1 T A 19: 20,595,301 (GRCm39) W77R probably damaging Het
Cc2d2a T C 5: 43,896,651 (GRCm39) I1516T probably benign Het
Ccdc149 T A 5: 52,562,436 (GRCm39) I197F probably damaging Het
Cfap119 A G 7: 127,187,125 (GRCm39) M46T probably benign Het
Cfb A G 17: 35,079,867 (GRCm39) V176A probably benign Het
Chordc1 A G 9: 18,213,397 (GRCm39) K83E probably benign Het
Cic G A 7: 24,971,384 (GRCm39) V372M probably benign Het
Coq2 T A 5: 100,811,741 (GRCm39) probably benign Het
Cradd A G 10: 95,158,573 (GRCm39) L58P probably damaging Het
Crim1 A T 17: 78,610,493 (GRCm39) D316V probably damaging Het
Cyb5rl C A 4: 106,928,205 (GRCm39) L114I possibly damaging Het
Cyp2c69 T G 19: 39,866,247 (GRCm39) probably null Het
Ddhd1 A G 14: 45,894,927 (GRCm39) F181S probably damaging Het
Dennd1b G A 1: 138,990,611 (GRCm39) E192K probably damaging Het
Dmrt1 T C 19: 25,483,383 (GRCm39) S56P possibly damaging Het
Dnah12 A G 14: 26,578,499 (GRCm39) E3086G possibly damaging Het
Dnah5 A T 15: 28,453,368 (GRCm39) M4380L probably benign Het
Dph7 A T 2: 24,861,624 (GRCm39) M346L probably benign Het
Eef1ece2 A G 16: 20,456,442 (GRCm39) E428G possibly damaging Het
Egf C T 3: 129,529,489 (GRCm39) R307H probably benign Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Fcna T C 2: 25,516,298 (GRCm39) K112E probably benign Het
Fkbp5 A T 17: 28,648,213 (GRCm39) N125K possibly damaging Het
Foxo3 C T 10: 42,073,765 (GRCm39) V251I possibly damaging Het
Fryl T A 5: 73,259,150 (GRCm39) probably null Het
Fsip2 A G 2: 82,781,365 (GRCm39) E253G possibly damaging Het
Gprc6a T A 10: 51,491,026 (GRCm39) T908S probably benign Het
Grin2c A T 11: 115,144,970 (GRCm39) F560L probably benign Het
Hao1 T A 2: 134,390,172 (GRCm39) N56Y probably damaging Het
Haus3 T C 5: 34,325,046 (GRCm39) I204M probably benign Het
Htr3b C A 9: 48,848,456 (GRCm39) C263F probably damaging Het
Ica1 A T 6: 8,742,274 (GRCm39) C120S probably benign Het
Inpp4a T A 1: 37,406,886 (GRCm39) S210T probably benign Het
Inpp5d T G 1: 87,633,671 (GRCm39) I699S probably damaging Het
Kcng1 A G 2: 168,104,904 (GRCm39) V314A probably benign Het
Lcn11 G A 2: 25,669,343 (GRCm39) V167M possibly damaging Het
Lingo3 C A 10: 80,670,382 (GRCm39) R516L probably benign Het
Lrmda T C 14: 22,646,546 (GRCm39) V151A probably damaging Het
Ly6g5b A C 17: 35,333,578 (GRCm39) I133R probably damaging Het
Mcidas G A 13: 113,135,521 (GRCm39) G315S probably damaging Het
Miip C T 4: 147,947,375 (GRCm39) G236S probably benign Het
Mroh7 T C 4: 106,564,773 (GRCm39) T562A probably benign Het
Nlrc4 A G 17: 74,734,114 (GRCm39) M933T probably benign Het
Pkhd1 A T 1: 20,345,759 (GRCm39) D2756E probably damaging Het
Plekhm2 T C 4: 141,359,432 (GRCm39) D445G probably damaging Het
Ppp1r12c C T 7: 4,486,354 (GRCm39) G605D probably benign Het
Pygb T A 2: 150,628,922 (GRCm39) N45K possibly damaging Het
Scn4b A G 9: 45,058,069 (GRCm39) T54A probably damaging Het
Scrt1 T A 15: 76,403,417 (GRCm39) H191L unknown Het
Sdc3 A G 4: 130,546,507 (GRCm39) M289V probably benign Het
Shb C T 4: 45,489,054 (GRCm39) probably null Het
Slc1a5 A G 7: 16,527,795 (GRCm39) T364A probably damaging Het
Slc25a27 A G 17: 43,960,564 (GRCm39) V218A probably benign Het
Slc39a4 C T 15: 76,498,285 (GRCm39) G384D probably damaging Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Styxl2 T A 1: 165,927,465 (GRCm39) N716Y possibly damaging Het
Tmem67 A T 4: 12,089,284 (GRCm39) probably null Het
Tonsl C T 15: 76,518,787 (GRCm39) R544H probably damaging Het
Trex1 A G 9: 108,887,157 (GRCm39) V278A unknown Het
Ttn A T 2: 76,625,501 (GRCm39) D15107E probably damaging Het
Tubgcp5 A G 7: 55,466,310 (GRCm39) T621A probably benign Het
Zfhx4 T C 3: 5,465,515 (GRCm39) V1916A possibly damaging Het
Zfp260 A T 7: 29,805,017 (GRCm39) K306* probably null Het
Zkscan7 A T 9: 122,724,974 (GRCm39) T648S probably benign Het
Zscan4c T A 7: 10,743,699 (GRCm39) F433I possibly damaging Het
Other mutations in Or13a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Or13a25 APN 7 140,247,854 (GRCm39) missense probably benign 0.01
IGL01610:Or13a25 APN 7 140,247,584 (GRCm39) missense probably damaging 1.00
IGL02959:Or13a25 APN 7 140,247,463 (GRCm39) missense probably damaging 1.00
IGL03406:Or13a25 APN 7 140,247,424 (GRCm39) missense probably damaging 1.00
R0671:Or13a25 UTSW 7 140,247,590 (GRCm39) missense probably damaging 1.00
R1771:Or13a25 UTSW 7 140,248,048 (GRCm39) missense probably benign
R1934:Or13a25 UTSW 7 140,247,951 (GRCm39) nonsense probably null
R1985:Or13a25 UTSW 7 140,247,734 (GRCm39) missense probably damaging 1.00
R2962:Or13a25 UTSW 7 140,247,862 (GRCm39) missense probably benign
R4239:Or13a25 UTSW 7 140,247,496 (GRCm39) missense probably benign 0.07
R4240:Or13a25 UTSW 7 140,247,496 (GRCm39) missense probably benign 0.07
R4360:Or13a25 UTSW 7 140,247,730 (GRCm39) missense probably damaging 0.98
R4841:Or13a25 UTSW 7 140,247,502 (GRCm39) missense probably damaging 1.00
R4842:Or13a25 UTSW 7 140,247,502 (GRCm39) missense probably damaging 1.00
R4851:Or13a25 UTSW 7 140,247,226 (GRCm39) missense probably benign
R5325:Or13a25 UTSW 7 140,247,705 (GRCm39) missense probably benign 0.33
R5766:Or13a25 UTSW 7 140,247,266 (GRCm39) missense probably benign 0.02
R6363:Or13a25 UTSW 7 140,247,995 (GRCm39) missense possibly damaging 0.93
R6836:Or13a25 UTSW 7 140,248,093 (GRCm39) missense possibly damaging 0.86
R7777:Or13a25 UTSW 7 140,247,854 (GRCm39) missense probably benign 0.01
R8134:Or13a25 UTSW 7 140,247,680 (GRCm39) missense possibly damaging 0.90
R8712:Or13a25 UTSW 7 140,248,052 (GRCm39) missense possibly damaging 0.89
R9095:Or13a25 UTSW 7 140,247,813 (GRCm39) missense probably damaging 1.00
R9158:Or13a25 UTSW 7 140,247,547 (GRCm39) missense possibly damaging 0.76
R9603:Or13a25 UTSW 7 140,247,794 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCGCTATGTGGCTATCTG -3'
(R):5'- TGAGTAGTACACAGAGACCACAATG -3'

Sequencing Primer
(F):5'- CTACACTACAGCTCTAGGATGAG -3'
(R):5'- TACACAGAGACCACAATGAGGTG -3'
Posted On 2020-09-15