Incidental Mutation 'R7920:Gprc6a'
ID648300
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene NameG protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7920 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location51614823-51631461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51614930 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 908 (T908S)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: T908S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: T908S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
AA Change: T733S

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
AA Change: T837S

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 41,996,173 S9P probably damaging Het
AI661453 A T 17: 47,468,406 Q1019L unknown Het
Aldh1a1 T A 19: 20,617,937 W77R probably damaging Het
Cc2d2a T C 5: 43,739,309 I1516T probably benign Het
Ccdc149 T A 5: 52,405,094 I197F probably damaging Het
Ccdc189 A G 7: 127,587,953 M46T probably benign Het
Cfb A G 17: 34,860,891 V176A probably benign Het
Chordc1 A G 9: 18,302,101 K83E probably benign Het
Cic G A 7: 25,271,959 V372M probably benign Het
Coq2 T A 5: 100,663,875 probably benign Het
Cradd A G 10: 95,322,711 L58P probably damaging Het
Crim1 A T 17: 78,303,064 D316V probably damaging Het
Cyb5rl C A 4: 107,071,008 L114I possibly damaging Het
Cyp2c69 T G 19: 39,877,803 probably null Het
Ddhd1 A G 14: 45,657,470 F181S probably damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dmrt1 T C 19: 25,506,019 S56P possibly damaging Het
Dnah12 A G 14: 26,856,542 E3086G possibly damaging Het
Dnah5 A T 15: 28,453,222 M4380L probably benign Het
Dph7 A T 2: 24,971,612 M346L probably benign Het
Dusp27 T A 1: 166,099,896 N716Y possibly damaging Het
Egf C T 3: 129,735,840 R307H probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fcna T C 2: 25,626,286 K112E probably benign Het
Fkbp5 A T 17: 28,429,239 N125K possibly damaging Het
Foxo3 C T 10: 42,197,769 V251I possibly damaging Het
Fryl T A 5: 73,101,807 probably null Het
Fsip2 A G 2: 82,951,021 E253G possibly damaging Het
Gm49333 A G 16: 20,637,692 E428G possibly damaging Het
Grin2c A T 11: 115,254,144 F560L probably benign Het
Hao1 T A 2: 134,548,252 N56Y probably damaging Het
Haus3 T C 5: 34,167,702 I204M probably benign Het
Htr3b C A 9: 48,937,156 C263F probably damaging Het
Ica1 A T 6: 8,742,274 C120S probably benign Het
Inpp4a T A 1: 37,367,805 S210T probably benign Het
Inpp5d T G 1: 87,705,949 I699S probably damaging Het
Kcng1 A G 2: 168,262,984 V314A probably benign Het
Lcn11 G A 2: 25,779,331 V167M possibly damaging Het
Lingo3 C A 10: 80,834,548 R516L probably benign Het
Lrmda T C 14: 22,596,478 V151A probably damaging Het
Ly6g5b A C 17: 35,114,602 I133R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mroh7 T C 4: 106,707,576 T562A probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Olfr539 A T 7: 140,667,901 S198C possibly damaging Het
Pkhd1 A T 1: 20,275,535 D2756E probably damaging Het
Plekhm2 T C 4: 141,632,121 D445G probably damaging Het
Ppp1r12c C T 7: 4,483,355 G605D probably benign Het
Pygb T A 2: 150,787,002 N45K possibly damaging Het
Scn4b A G 9: 45,146,771 T54A probably damaging Het
Scrt1 T A 15: 76,519,217 H191L unknown Het
Sdc3 A G 4: 130,819,196 M289V probably benign Het
Shb C T 4: 45,489,054 probably null Het
Slc1a5 A G 7: 16,793,870 T364A probably damaging Het
Slc25a27 A G 17: 43,649,673 V218A probably benign Het
Slc39a4 C T 15: 76,614,085 G384D probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Tmem67 A T 4: 12,089,284 probably null Het
Tonsl C T 15: 76,634,587 R544H probably damaging Het
Trex1 A G 9: 109,058,089 V278A unknown Het
Ttn A T 2: 76,795,157 D15107E probably damaging Het
Tubgcp5 A G 7: 55,816,562 T621A probably benign Het
Zfhx4 T C 3: 5,400,455 V1916A possibly damaging Het
Zfp260 A T 7: 30,105,592 K306* probably null Het
Zkscan7 A T 9: 122,895,909 T648S probably benign Het
Zscan4c T A 7: 11,009,772 F433I possibly damaging Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
R8273:Gprc6a UTSW 10 51631274 missense probably benign
R8329:Gprc6a UTSW 10 51627259 nonsense probably null
R8517:Gprc6a UTSW 10 51631241 missense probably benign 0.00
R8723:Gprc6a UTSW 10 51615422 missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51620983 missense probably benign 0.00
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAACAGTGTTCAAGCAAATGGC -3'
(R):5'- TTCCTCCAGATGGTTTACAACTAC -3'

Sequencing Primer
(F):5'- GCCAAAACCAAACCAACCAAACAG -3'
(R):5'- AACTACTCTGCTCACAGTGTGGAC -3'
Posted On2020-09-15