Incidental Mutation 'R7920:Dnah5'
ID 648310
Institutional Source Beutler Lab
Gene Symbol Dnah5
Ensembl Gene ENSMUSG00000022262
Gene Name dynein, axonemal, heavy chain 5
Synonyms b2b1565Clo, b2b1134Clo, Mdnah5, b2b1537Clo, b2b1154Clo, Dnahc5
MMRRC Submission 045967-MU
Accession Numbers

NCBI RefSeq: NM_133365.3; MGI: 107718

Essential gene? Probably essential (E-score: 0.776) question?
Stock # R7920 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 28203752-28472052 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 28453222 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 4380 (M4380L)
Ref Sequence ENSEMBL: ENSMUSP00000069751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067048]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000067048
AA Change: M4380L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: M4380L

DomainStartEndE-ValueType
Pfam:DHC_N1 247 802 2.3e-163 PFAM
low complexity region 1077 1088 N/A INTRINSIC
low complexity region 1113 1128 N/A INTRINSIC
Pfam:DHC_N2 1399 1807 2.3e-134 PFAM
AAA 1972 2108 2e-3 SMART
AAA 2251 2424 4.3e-3 SMART
AAA 2579 2777 2.2e-3 SMART
low complexity region 2874 2889 N/A INTRINSIC
Pfam:AAA_8 2914 3186 3.2e-70 PFAM
Pfam:MT 3198 3546 1e-44 PFAM
Pfam:AAA_9 3567 3792 1.4e-86 PFAM
low complexity region 3889 3899 N/A INTRINSIC
Pfam:Dynein_heavy 3930 4618 4.4e-246 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype Strain: 2180081
Lethality: D14-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 41,996,173 (GRCm38) S9P probably damaging Het
AI661453 A T 17: 47,468,406 (GRCm38) Q1019L unknown Het
Aldh1a1 T A 19: 20,617,937 (GRCm38) W77R probably damaging Het
Cc2d2a T C 5: 43,739,309 (GRCm38) I1516T probably benign Het
Ccdc149 T A 5: 52,405,094 (GRCm38) I197F probably damaging Het
Ccdc189 A G 7: 127,587,953 (GRCm38) M46T probably benign Het
Cfb A G 17: 34,860,891 (GRCm38) V176A probably benign Het
Chordc1 A G 9: 18,302,101 (GRCm38) K83E probably benign Het
Cic G A 7: 25,271,959 (GRCm38) V372M probably benign Het
Coq2 T A 5: 100,663,875 (GRCm38) probably benign Het
Cradd A G 10: 95,322,711 (GRCm38) L58P probably damaging Het
Crim1 A T 17: 78,303,064 (GRCm38) D316V probably damaging Het
Cyb5rl C A 4: 107,071,008 (GRCm38) L114I possibly damaging Het
Cyp2c69 T G 19: 39,877,803 (GRCm38) probably null Het
Ddhd1 A G 14: 45,657,470 (GRCm38) F181S probably damaging Het
Dennd1b G A 1: 139,062,873 (GRCm38) E192K probably damaging Het
Dmrt1 T C 19: 25,506,019 (GRCm38) S56P possibly damaging Het
Dnah12 A G 14: 26,856,542 (GRCm38) E3086G possibly damaging Het
Dph7 A T 2: 24,971,612 (GRCm38) M346L probably benign Het
Dusp27 T A 1: 166,099,896 (GRCm38) N716Y possibly damaging Het
Egf C T 3: 129,735,840 (GRCm38) R307H probably benign Het
Fam50b G A 13: 34,747,101 (GRCm38) E187K possibly damaging Het
Fcna T C 2: 25,626,286 (GRCm38) K112E probably benign Het
Fkbp5 A T 17: 28,429,239 (GRCm38) N125K possibly damaging Het
Foxo3 C T 10: 42,197,769 (GRCm38) V251I possibly damaging Het
Fryl T A 5: 73,101,807 (GRCm38) probably null Het
Fsip2 A G 2: 82,951,021 (GRCm38) E253G possibly damaging Het
Gm49333 A G 16: 20,637,692 (GRCm38) E428G possibly damaging Het
Gprc6a T A 10: 51,614,930 (GRCm38) T908S probably benign Het
Grin2c A T 11: 115,254,144 (GRCm38) F560L probably benign Het
Hao1 T A 2: 134,548,252 (GRCm38) N56Y probably damaging Het
Haus3 T C 5: 34,167,702 (GRCm38) I204M probably benign Het
Htr3b C A 9: 48,937,156 (GRCm38) C263F probably damaging Het
Ica1 A T 6: 8,742,274 (GRCm38) C120S probably benign Het
Inpp4a T A 1: 37,367,805 (GRCm38) S210T probably benign Het
Inpp5d T G 1: 87,705,949 (GRCm38) I699S probably damaging Het
Kcng1 A G 2: 168,262,984 (GRCm38) V314A probably benign Het
Lcn11 G A 2: 25,779,331 (GRCm38) V167M possibly damaging Het
Lingo3 C A 10: 80,834,548 (GRCm38) R516L probably benign Het
Lrmda T C 14: 22,596,478 (GRCm38) V151A probably damaging Het
Ly6g5b A C 17: 35,114,602 (GRCm38) I133R probably damaging Het
Mcidas G A 13: 112,998,987 (GRCm38) G315S probably damaging Het
Miip C T 4: 147,862,918 (GRCm38) G236S probably benign Het
Mroh7 T C 4: 106,707,576 (GRCm38) T562A probably benign Het
Nlrc4 A G 17: 74,427,119 (GRCm38) M933T probably benign Het
Olfr539 A T 7: 140,667,901 (GRCm38) S198C possibly damaging Het
Pkhd1 A T 1: 20,275,535 (GRCm38) D2756E probably damaging Het
Plekhm2 T C 4: 141,632,121 (GRCm38) D445G probably damaging Het
Ppp1r12c C T 7: 4,483,355 (GRCm38) G605D probably benign Het
Pygb T A 2: 150,787,002 (GRCm38) N45K possibly damaging Het
Scn4b A G 9: 45,146,771 (GRCm38) T54A probably damaging Het
Scrt1 T A 15: 76,519,217 (GRCm38) H191L unknown Het
Sdc3 A G 4: 130,819,196 (GRCm38) M289V probably benign Het
Shb C T 4: 45,489,054 (GRCm38) probably null Het
Slc1a5 A G 7: 16,793,870 (GRCm38) T364A probably damaging Het
Slc25a27 A G 17: 43,649,673 (GRCm38) V218A probably benign Het
Slc39a4 C T 15: 76,614,085 (GRCm38) G384D probably damaging Het
Sptbn2 C G 19: 4,749,012 (GRCm38) R2037G probably benign Het
Tmem67 A T 4: 12,089,284 (GRCm38) probably null Het
Tonsl C T 15: 76,634,587 (GRCm38) R544H probably damaging Het
Trex1 A G 9: 109,058,089 (GRCm38) V278A unknown Het
Ttn A T 2: 76,795,157 (GRCm38) D15107E probably damaging Het
Tubgcp5 A G 7: 55,816,562 (GRCm38) T621A probably benign Het
Zfhx4 T C 3: 5,400,455 (GRCm38) V1916A possibly damaging Het
Zfp260 A T 7: 30,105,592 (GRCm38) K306* probably null Het
Zkscan7 A T 9: 122,895,909 (GRCm38) T648S probably benign Het
Zscan4c T A 7: 11,009,772 (GRCm38) F433I possibly damaging Het
Other mutations in Dnah5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dnah5 APN 15 28,272,342 (GRCm38) missense probably benign
IGL00331:Dnah5 APN 15 28,421,620 (GRCm38) missense probably damaging 1.00
IGL00519:Dnah5 APN 15 28,444,218 (GRCm38) missense probably benign 0.10
IGL00537:Dnah5 APN 15 28,458,702 (GRCm38) critical splice donor site probably null
IGL01102:Dnah5 APN 15 28,410,003 (GRCm38) critical splice donor site probably null
IGL01126:Dnah5 APN 15 28,302,399 (GRCm38) missense possibly damaging 0.85
IGL01154:Dnah5 APN 15 28,458,656 (GRCm38) missense possibly damaging 0.75
IGL01349:Dnah5 APN 15 28,294,913 (GRCm38) splice site probably benign
IGL01353:Dnah5 APN 15 28,233,272 (GRCm38) missense probably benign 0.00
IGL01372:Dnah5 APN 15 28,230,490 (GRCm38) missense probably benign 0.00
IGL01390:Dnah5 APN 15 28,411,540 (GRCm38) missense probably benign 0.00
IGL01446:Dnah5 APN 15 28,326,669 (GRCm38) missense probably damaging 1.00
IGL01472:Dnah5 APN 15 28,331,726 (GRCm38) missense probably damaging 1.00
IGL01485:Dnah5 APN 15 28,331,726 (GRCm38) missense probably damaging 1.00
IGL01568:Dnah5 APN 15 28,229,652 (GRCm38) missense probably benign 0.01
IGL01592:Dnah5 APN 15 28,236,637 (GRCm38) missense probably benign 0.01
IGL01594:Dnah5 APN 15 28,311,334 (GRCm38) missense possibly damaging 0.87
IGL01677:Dnah5 APN 15 28,367,782 (GRCm38) missense probably damaging 1.00
IGL01845:Dnah5 APN 15 28,449,169 (GRCm38) missense probably benign 0.06
IGL01904:Dnah5 APN 15 28,307,364 (GRCm38) missense probably benign 0.09
IGL01913:Dnah5 APN 15 28,313,753 (GRCm38) missense possibly damaging 0.50
IGL01950:Dnah5 APN 15 28,290,289 (GRCm38) missense probably null 1.00
IGL01963:Dnah5 APN 15 28,370,536 (GRCm38) missense probably benign 0.12
IGL02008:Dnah5 APN 15 28,343,552 (GRCm38) missense probably damaging 0.98
IGL02088:Dnah5 APN 15 28,459,118 (GRCm38) critical splice acceptor site probably null
IGL02090:Dnah5 APN 15 28,240,041 (GRCm38) splice site probably benign
IGL02114:Dnah5 APN 15 28,397,124 (GRCm38) missense probably damaging 0.97
IGL02135:Dnah5 APN 15 28,247,885 (GRCm38) missense possibly damaging 0.50
IGL02232:Dnah5 APN 15 28,299,240 (GRCm38) missense probably damaging 1.00
IGL02386:Dnah5 APN 15 28,340,381 (GRCm38) missense probably damaging 1.00
IGL02475:Dnah5 APN 15 28,219,150 (GRCm38) missense probably benign 0.09
IGL02626:Dnah5 APN 15 28,307,276 (GRCm38) missense possibly damaging 0.94
IGL02650:Dnah5 APN 15 28,289,047 (GRCm38) splice site probably benign
IGL02651:Dnah5 APN 15 28,350,622 (GRCm38) missense probably benign 0.05
IGL02652:Dnah5 APN 15 28,366,187 (GRCm38) missense probably damaging 0.99
IGL02670:Dnah5 APN 15 28,409,296 (GRCm38) missense probably damaging 1.00
IGL02697:Dnah5 APN 15 28,445,143 (GRCm38) missense probably benign 0.00
IGL02721:Dnah5 APN 15 28,234,243 (GRCm38) critical splice acceptor site probably null
IGL02858:Dnah5 APN 15 28,453,212 (GRCm38) missense possibly damaging 0.65
IGL02859:Dnah5 APN 15 28,383,625 (GRCm38) missense probably benign 0.01
IGL02945:Dnah5 APN 15 28,270,426 (GRCm38) missense probably benign 0.00
IGL02949:Dnah5 APN 15 28,272,185 (GRCm38) missense probably benign 0.32
IGL02971:Dnah5 APN 15 28,384,461 (GRCm38) missense probably damaging 1.00
IGL03017:Dnah5 APN 15 28,340,325 (GRCm38) missense possibly damaging 0.93
IGL03177:Dnah5 APN 15 28,295,399 (GRCm38) missense probably damaging 0.97
IGL03212:Dnah5 APN 15 28,290,163 (GRCm38) missense probably benign 0.08
IGL03224:Dnah5 APN 15 28,459,154 (GRCm38) missense probably damaging 1.00
IGL03231:Dnah5 APN 15 28,311,148 (GRCm38) missense probably damaging 1.00
IGL03273:Dnah5 APN 15 28,458,649 (GRCm38) missense probably damaging 0.98
IGL03294:Dnah5 APN 15 28,233,295 (GRCm38) critical splice donor site probably null
IGL03331:Dnah5 APN 15 28,419,940 (GRCm38) missense probably damaging 1.00
IGL03337:Dnah5 APN 15 28,290,141 (GRCm38) missense probably benign 0.10
IGL03367:Dnah5 APN 15 28,234,327 (GRCm38) missense possibly damaging 0.95
Firtel UTSW 15 28,448,367 (GRCm38) missense possibly damaging 0.95
lowbar UTSW 15 28,311,133 (GRCm38) splice site probably null
notherone UTSW 15 28,340,406 (GRCm38) missense probably benign 0.13
scheffler UTSW 15 28,438,091 (GRCm38) splice site probably benign
IGL02837:Dnah5 UTSW 15 28,269,400 (GRCm38) missense probably benign
P0008:Dnah5 UTSW 15 28,302,387 (GRCm38) missense probably damaging 1.00
P0014:Dnah5 UTSW 15 28,403,473 (GRCm38) missense probably damaging 1.00
PIT4687001:Dnah5 UTSW 15 28,383,577 (GRCm38) missense probably damaging 0.98
R0030:Dnah5 UTSW 15 28,451,517 (GRCm38) missense probably benign 0.34
R0087:Dnah5 UTSW 15 28,350,613 (GRCm38) missense probably damaging 1.00
R0099:Dnah5 UTSW 15 28,239,934 (GRCm38) missense probably damaging 1.00
R0102:Dnah5 UTSW 15 28,245,751 (GRCm38) splice site probably benign
R0102:Dnah5 UTSW 15 28,245,751 (GRCm38) splice site probably benign
R0104:Dnah5 UTSW 15 28,453,353 (GRCm38) missense possibly damaging 0.88
R0112:Dnah5 UTSW 15 28,263,679 (GRCm38) missense probably benign 0.00
R0122:Dnah5 UTSW 15 28,378,363 (GRCm38) missense probably damaging 1.00
R0126:Dnah5 UTSW 15 28,246,319 (GRCm38) missense probably benign 0.00
R0127:Dnah5 UTSW 15 28,294,925 (GRCm38) missense probably damaging 1.00
R0233:Dnah5 UTSW 15 28,333,070 (GRCm38) missense probably damaging 1.00
R0310:Dnah5 UTSW 15 28,299,110 (GRCm38) missense probably benign 0.19
R0386:Dnah5 UTSW 15 28,383,581 (GRCm38) missense probably damaging 1.00
R0421:Dnah5 UTSW 15 28,229,541 (GRCm38) missense possibly damaging 0.79
R0481:Dnah5 UTSW 15 28,383,599 (GRCm38) missense probably benign 0.31
R0514:Dnah5 UTSW 15 28,366,321 (GRCm38) missense probably damaging 1.00
R0609:Dnah5 UTSW 15 28,327,779 (GRCm38) missense probably benign
R0720:Dnah5 UTSW 15 28,313,861 (GRCm38) missense probably null 0.98
R0731:Dnah5 UTSW 15 28,311,143 (GRCm38) missense possibly damaging 0.78
R0747:Dnah5 UTSW 15 28,444,187 (GRCm38) missense possibly damaging 0.64
R0747:Dnah5 UTSW 15 28,444,186 (GRCm38) missense probably damaging 0.99
R0766:Dnah5 UTSW 15 28,448,487 (GRCm38) missense probably null 0.89
R0849:Dnah5 UTSW 15 28,263,599 (GRCm38) missense probably damaging 0.96
R1034:Dnah5 UTSW 15 28,302,471 (GRCm38) missense probably damaging 1.00
R1084:Dnah5 UTSW 15 28,343,452 (GRCm38) missense probably benign 0.01
R1148:Dnah5 UTSW 15 28,421,690 (GRCm38) missense probably damaging 1.00
R1148:Dnah5 UTSW 15 28,421,690 (GRCm38) missense probably damaging 1.00
R1200:Dnah5 UTSW 15 28,246,257 (GRCm38) missense possibly damaging 0.88
R1208:Dnah5 UTSW 15 28,327,731 (GRCm38) missense probably damaging 1.00
R1208:Dnah5 UTSW 15 28,327,731 (GRCm38) missense probably damaging 1.00
R1269:Dnah5 UTSW 15 28,238,511 (GRCm38) missense probably damaging 1.00
R1373:Dnah5 UTSW 15 28,313,918 (GRCm38) splice site probably benign
R1401:Dnah5 UTSW 15 28,401,913 (GRCm38) missense probably damaging 1.00
R1413:Dnah5 UTSW 15 28,370,409 (GRCm38) missense probably benign
R1430:Dnah5 UTSW 15 28,345,857 (GRCm38) missense probably benign 0.37
R1457:Dnah5 UTSW 15 28,403,542 (GRCm38) critical splice donor site probably null
R1468:Dnah5 UTSW 15 28,230,463 (GRCm38) nonsense probably null
R1468:Dnah5 UTSW 15 28,230,463 (GRCm38) nonsense probably null
R1560:Dnah5 UTSW 15 28,420,003 (GRCm38) missense probably damaging 1.00
R1568:Dnah5 UTSW 15 28,409,177 (GRCm38) missense probably damaging 0.98
R1574:Dnah5 UTSW 15 28,252,423 (GRCm38) missense probably benign 0.00
R1574:Dnah5 UTSW 15 28,252,423 (GRCm38) missense probably benign 0.00
R1603:Dnah5 UTSW 15 28,449,180 (GRCm38) missense probably benign 0.09
R1603:Dnah5 UTSW 15 28,294,985 (GRCm38) splice site probably benign
R1673:Dnah5 UTSW 15 28,290,148 (GRCm38) missense probably benign
R1755:Dnah5 UTSW 15 28,326,636 (GRCm38) missense probably damaging 0.99
R1785:Dnah5 UTSW 15 28,313,786 (GRCm38) missense probably damaging 1.00
R1786:Dnah5 UTSW 15 28,313,786 (GRCm38) missense probably damaging 1.00
R1789:Dnah5 UTSW 15 28,270,426 (GRCm38) missense probably benign 0.00
R1817:Dnah5 UTSW 15 28,246,400 (GRCm38) nonsense probably null
R1819:Dnah5 UTSW 15 28,246,400 (GRCm38) nonsense probably null
R1834:Dnah5 UTSW 15 28,409,124 (GRCm38) missense probably benign 0.00
R1855:Dnah5 UTSW 15 28,411,669 (GRCm38) missense possibly damaging 0.88
R1870:Dnah5 UTSW 15 28,331,713 (GRCm38) nonsense probably null
R1871:Dnah5 UTSW 15 28,331,713 (GRCm38) nonsense probably null
R1987:Dnah5 UTSW 15 28,343,591 (GRCm38) missense probably damaging 0.99
R1988:Dnah5 UTSW 15 28,343,591 (GRCm38) missense probably damaging 0.99
R1989:Dnah5 UTSW 15 28,343,591 (GRCm38) missense probably damaging 0.99
R2062:Dnah5 UTSW 15 28,366,270 (GRCm38) missense probably damaging 1.00
R2069:Dnah5 UTSW 15 28,312,388 (GRCm38) splice site probably null
R2121:Dnah5 UTSW 15 28,297,005 (GRCm38) splice site probably benign
R2128:Dnah5 UTSW 15 28,408,321 (GRCm38) missense probably benign 0.00
R2129:Dnah5 UTSW 15 28,408,321 (GRCm38) missense probably benign 0.00
R2151:Dnah5 UTSW 15 28,444,091 (GRCm38) missense probably damaging 1.00
R2159:Dnah5 UTSW 15 28,252,545 (GRCm38) missense probably benign 0.00
R2207:Dnah5 UTSW 15 28,343,671 (GRCm38) missense probably benign 0.11
R2231:Dnah5 UTSW 15 28,408,417 (GRCm38) critical splice donor site probably null
R2232:Dnah5 UTSW 15 28,408,417 (GRCm38) critical splice donor site probably null
R2282:Dnah5 UTSW 15 28,327,302 (GRCm38) missense probably damaging 0.99
R2305:Dnah5 UTSW 15 28,387,767 (GRCm38) missense probably benign 0.25
R2339:Dnah5 UTSW 15 28,313,882 (GRCm38) missense probably benign 0.00
R2437:Dnah5 UTSW 15 28,307,391 (GRCm38) critical splice donor site probably null
R2696:Dnah5 UTSW 15 28,278,576 (GRCm38) missense probably benign 0.00
R3156:Dnah5 UTSW 15 28,438,091 (GRCm38) splice site probably benign
R3431:Dnah5 UTSW 15 28,295,267 (GRCm38) missense probably benign 0.20
R3700:Dnah5 UTSW 15 28,387,791 (GRCm38) missense possibly damaging 0.72
R3724:Dnah5 UTSW 15 28,270,420 (GRCm38) missense probably benign 0.08
R3732:Dnah5 UTSW 15 28,409,122 (GRCm38) missense possibly damaging 0.64
R3872:Dnah5 UTSW 15 28,411,510 (GRCm38) missense possibly damaging 0.50
R4063:Dnah5 UTSW 15 28,420,998 (GRCm38) missense probably damaging 0.98
R4072:Dnah5 UTSW 15 28,340,298 (GRCm38) nonsense probably null
R4075:Dnah5 UTSW 15 28,293,791 (GRCm38) missense probably benign
R4245:Dnah5 UTSW 15 28,219,189 (GRCm38) missense probably benign
R4254:Dnah5 UTSW 15 28,438,102 (GRCm38) missense probably benign 0.07
R4255:Dnah5 UTSW 15 28,438,102 (GRCm38) missense probably benign 0.07
R4392:Dnah5 UTSW 15 28,289,229 (GRCm38) missense probably benign 0.19
R4552:Dnah5 UTSW 15 28,397,154 (GRCm38) missense probably benign 0.19
R4574:Dnah5 UTSW 15 28,367,763 (GRCm38) missense probably benign 0.05
R4577:Dnah5 UTSW 15 28,289,250 (GRCm38) missense probably benign 0.06
R4587:Dnah5 UTSW 15 28,304,599 (GRCm38) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,419,994 (GRCm38) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,401,953 (GRCm38) missense probably damaging 1.00
R4676:Dnah5 UTSW 15 28,295,260 (GRCm38) missense possibly damaging 0.65
R4707:Dnah5 UTSW 15 28,372,375 (GRCm38) missense probably damaging 0.97
R4754:Dnah5 UTSW 15 28,420,955 (GRCm38) splice site probably null
R4767:Dnah5 UTSW 15 28,270,474 (GRCm38) missense probably benign 0.02
R4857:Dnah5 UTSW 15 28,345,807 (GRCm38) missense probably benign 0.00
R4883:Dnah5 UTSW 15 28,343,638 (GRCm38) missense probably benign 0.00
R4889:Dnah5 UTSW 15 28,235,792 (GRCm38) missense probably benign 0.01
R4946:Dnah5 UTSW 15 28,387,904 (GRCm38) missense probably damaging 1.00
R4946:Dnah5 UTSW 15 28,326,557 (GRCm38) missense probably damaging 0.96
R4947:Dnah5 UTSW 15 28,272,372 (GRCm38) missense probably benign
R5033:Dnah5 UTSW 15 28,421,678 (GRCm38) missense probably damaging 0.96
R5164:Dnah5 UTSW 15 28,408,292 (GRCm38) missense probably benign 0.00
R5175:Dnah5 UTSW 15 28,448,404 (GRCm38) missense probably damaging 1.00
R5182:Dnah5 UTSW 15 28,311,278 (GRCm38) missense probably damaging 0.99
R5187:Dnah5 UTSW 15 28,272,172 (GRCm38) missense probably benign 0.41
R5272:Dnah5 UTSW 15 28,350,665 (GRCm38) missense probably benign
R5308:Dnah5 UTSW 15 28,229,651 (GRCm38) missense possibly damaging 0.80
R5310:Dnah5 UTSW 15 28,311,328 (GRCm38) missense probably damaging 1.00
R5322:Dnah5 UTSW 15 28,384,244 (GRCm38) missense probably benign 0.41
R5398:Dnah5 UTSW 15 28,293,726 (GRCm38) missense probably benign
R5596:Dnah5 UTSW 15 28,343,608 (GRCm38) missense probably damaging 1.00
R5603:Dnah5 UTSW 15 28,419,932 (GRCm38) missense probably damaging 1.00
R5619:Dnah5 UTSW 15 28,302,435 (GRCm38) missense probably damaging 1.00
R5656:Dnah5 UTSW 15 28,421,064 (GRCm38) missense probably benign 0.03
R5741:Dnah5 UTSW 15 28,246,367 (GRCm38) missense probably benign 0.11
R5754:Dnah5 UTSW 15 28,401,868 (GRCm38) missense probably benign 0.01
R5763:Dnah5 UTSW 15 28,311,152 (GRCm38) missense probably damaging 1.00
R5824:Dnah5 UTSW 15 28,313,821 (GRCm38) missense probably benign 0.00
R5836:Dnah5 UTSW 15 28,383,592 (GRCm38) missense probably damaging 1.00
R5838:Dnah5 UTSW 15 28,290,195 (GRCm38) missense probably benign 0.00
R5864:Dnah5 UTSW 15 28,297,013 (GRCm38) missense possibly damaging 0.83
R5895:Dnah5 UTSW 15 28,234,453 (GRCm38) splice site probably null
R5896:Dnah5 UTSW 15 28,272,060 (GRCm38) missense probably benign
R5899:Dnah5 UTSW 15 28,448,367 (GRCm38) missense possibly damaging 0.95
R5905:Dnah5 UTSW 15 28,387,833 (GRCm38) missense probably damaging 1.00
R5924:Dnah5 UTSW 15 28,307,327 (GRCm38) missense probably benign 0.41
R5927:Dnah5 UTSW 15 28,335,718 (GRCm38) missense probably benign 0.00
R5929:Dnah5 UTSW 15 28,311,208 (GRCm38) missense probably damaging 1.00
R5929:Dnah5 UTSW 15 28,311,207 (GRCm38) missense probably benign 0.01
R5931:Dnah5 UTSW 15 28,453,279 (GRCm38) missense probably damaging 0.99
R5964:Dnah5 UTSW 15 28,458,584 (GRCm38) missense possibly damaging 0.49
R5975:Dnah5 UTSW 15 28,234,282 (GRCm38) missense probably damaging 1.00
R5993:Dnah5 UTSW 15 28,299,226 (GRCm38) missense probably benign 0.09
R6016:Dnah5 UTSW 15 28,327,884 (GRCm38) missense probably damaging 1.00
R6028:Dnah5 UTSW 15 28,387,833 (GRCm38) missense probably damaging 1.00
R6065:Dnah5 UTSW 15 28,230,468 (GRCm38) missense possibly damaging 0.47
R6117:Dnah5 UTSW 15 28,270,420 (GRCm38) missense probably damaging 0.99
R6143:Dnah5 UTSW 15 28,233,231 (GRCm38) missense probably benign 0.05
R6146:Dnah5 UTSW 15 28,459,185 (GRCm38) missense probably benign
R6154:Dnah5 UTSW 15 28,204,031 (GRCm38) missense probably benign 0.15
R6164:Dnah5 UTSW 15 28,378,343 (GRCm38) missense probably benign 0.08
R6266:Dnah5 UTSW 15 28,335,627 (GRCm38) missense possibly damaging 0.67
R6321:Dnah5 UTSW 15 28,372,411 (GRCm38) missense probably damaging 0.99
R6349:Dnah5 UTSW 15 28,238,511 (GRCm38) missense probably damaging 1.00
R6431:Dnah5 UTSW 15 28,349,824 (GRCm38) missense possibly damaging 0.52
R6467:Dnah5 UTSW 15 28,438,183 (GRCm38) missense probably benign 0.10
R6564:Dnah5 UTSW 15 28,367,745 (GRCm38) missense probably benign
R6607:Dnah5 UTSW 15 28,445,200 (GRCm38) missense possibly damaging 0.95
R6619:Dnah5 UTSW 15 28,409,120 (GRCm38) missense probably benign 0.03
R6633:Dnah5 UTSW 15 28,293,787 (GRCm38) missense probably benign 0.27
R6647:Dnah5 UTSW 15 28,403,487 (GRCm38) missense probably benign 0.02
R6782:Dnah5 UTSW 15 28,449,156 (GRCm38) missense possibly damaging 0.89
R6797:Dnah5 UTSW 15 28,233,238 (GRCm38) nonsense probably null
R6797:Dnah5 UTSW 15 28,451,463 (GRCm38) missense probably damaging 1.00
R6831:Dnah5 UTSW 15 28,411,515 (GRCm38) missense possibly damaging 0.88
R6849:Dnah5 UTSW 15 28,278,624 (GRCm38) missense probably benign 0.14
R6871:Dnah5 UTSW 15 28,229,640 (GRCm38) missense probably benign 0.32
R6936:Dnah5 UTSW 15 28,409,268 (GRCm38) missense probably damaging 1.00
R6943:Dnah5 UTSW 15 28,235,720 (GRCm38) missense probably damaging 1.00
R7030:Dnah5 UTSW 15 28,333,062 (GRCm38) missense probably benign 0.00
R7030:Dnah5 UTSW 15 28,238,592 (GRCm38) missense probably benign
R7032:Dnah5 UTSW 15 28,326,650 (GRCm38) missense probably damaging 1.00
R7063:Dnah5 UTSW 15 28,233,248 (GRCm38) missense probably benign 0.00
R7094:Dnah5 UTSW 15 28,453,336 (GRCm38) missense probably damaging 0.98
R7097:Dnah5 UTSW 15 28,453,264 (GRCm38) missense probably benign 0.00
R7126:Dnah5 UTSW 15 28,349,837 (GRCm38) missense probably benign 0.03
R7153:Dnah5 UTSW 15 28,365,522 (GRCm38) splice site probably null
R7209:Dnah5 UTSW 15 28,459,225 (GRCm38) missense possibly damaging 0.71
R7276:Dnah5 UTSW 15 28,367,838 (GRCm38) missense probably damaging 1.00
R7320:Dnah5 UTSW 15 28,270,470 (GRCm38) missense probably null 0.33
R7350:Dnah5 UTSW 15 28,235,819 (GRCm38) critical splice donor site probably null
R7380:Dnah5 UTSW 15 28,370,378 (GRCm38) missense probably damaging 1.00
R7438:Dnah5 UTSW 15 28,346,952 (GRCm38) missense probably damaging 0.99
R7499:Dnah5 UTSW 15 28,302,450 (GRCm38) missense probably damaging 1.00
R7513:Dnah5 UTSW 15 28,370,415 (GRCm38) missense probably benign
R7519:Dnah5 UTSW 15 28,390,483 (GRCm38) missense probably damaging 0.98
R7524:Dnah5 UTSW 15 28,297,066 (GRCm38) missense possibly damaging 0.50
R7556:Dnah5 UTSW 15 28,290,243 (GRCm38) missense probably null 0.43
R7570:Dnah5 UTSW 15 28,346,952 (GRCm38) missense probably damaging 1.00
R7585:Dnah5 UTSW 15 28,401,868 (GRCm38) missense probably benign 0.09
R7642:Dnah5 UTSW 15 28,247,979 (GRCm38) critical splice donor site probably null
R7670:Dnah5 UTSW 15 28,246,232 (GRCm38) splice site probably null
R7763:Dnah5 UTSW 15 28,313,855 (GRCm38) missense probably damaging 1.00
R7821:Dnah5 UTSW 15 28,411,532 (GRCm38) missense possibly damaging 0.89
R7826:Dnah5 UTSW 15 28,367,812 (GRCm38) missense probably damaging 1.00
R7872:Dnah5 UTSW 15 28,245,684 (GRCm38) missense probably damaging 0.99
R7889:Dnah5 UTSW 15 28,448,414 (GRCm38) nonsense probably null
R7919:Dnah5 UTSW 15 28,350,596 (GRCm38) missense probably damaging 1.00
R7936:Dnah5 UTSW 15 28,345,837 (GRCm38) missense possibly damaging 0.64
R7996:Dnah5 UTSW 15 28,409,177 (GRCm38) missense probably damaging 0.98
R8063:Dnah5 UTSW 15 28,230,583 (GRCm38) missense probably benign
R8084:Dnah5 UTSW 15 28,387,953 (GRCm38) missense probably damaging 1.00
R8105:Dnah5 UTSW 15 28,372,402 (GRCm38) missense probably benign
R8114:Dnah5 UTSW 15 28,239,976 (GRCm38) missense probably benign 0.01
R8142:Dnah5 UTSW 15 28,384,373 (GRCm38) missense probably benign 0.36
R8153:Dnah5 UTSW 15 28,384,430 (GRCm38) missense probably damaging 1.00
R8161:Dnah5 UTSW 15 28,350,704 (GRCm38) missense possibly damaging 0.79
R8174:Dnah5 UTSW 15 28,311,133 (GRCm38) splice site probably null
R8187:Dnah5 UTSW 15 28,384,209 (GRCm38) missense probably damaging 1.00
R8194:Dnah5 UTSW 15 28,453,268 (GRCm38) missense probably damaging 0.99
R8280:Dnah5 UTSW 15 28,408,392 (GRCm38) missense probably benign 0.01
R8291:Dnah5 UTSW 15 28,263,597 (GRCm38) missense probably benign 0.03
R8324:Dnah5 UTSW 15 28,346,865 (GRCm38) missense probably damaging 1.00
R8347:Dnah5 UTSW 15 28,236,666 (GRCm38) missense possibly damaging 0.90
R8356:Dnah5 UTSW 15 28,444,167 (GRCm38) missense probably benign 0.03
R8356:Dnah5 UTSW 15 28,444,323 (GRCm38) missense probably null 0.02
R8361:Dnah5 UTSW 15 28,331,810 (GRCm38) missense probably damaging 0.98
R8375:Dnah5 UTSW 15 28,327,343 (GRCm38) missense probably benign 0.00
R8474:Dnah5 UTSW 15 28,247,832 (GRCm38) missense probably benign 0.00
R8481:Dnah5 UTSW 15 28,419,795 (GRCm38) missense probably benign 0.00
R8494:Dnah5 UTSW 15 28,345,831 (GRCm38) missense probably benign 0.32
R8495:Dnah5 UTSW 15 28,409,268 (GRCm38) missense probably damaging 0.97
R8519:Dnah5 UTSW 15 28,299,099 (GRCm38) missense probably benign 0.07
R8683:Dnah5 UTSW 15 28,289,221 (GRCm38) missense probably benign 0.00
R8739:Dnah5 UTSW 15 28,345,860 (GRCm38) missense probably benign 0.01
R8752:Dnah5 UTSW 15 28,290,219 (GRCm38) missense probably benign 0.00
R8784:Dnah5 UTSW 15 28,387,951 (GRCm38) missense probably benign 0.16
R8813:Dnah5 UTSW 15 28,229,573 (GRCm38) missense probably damaging 1.00
R8862:Dnah5 UTSW 15 28,459,356 (GRCm38) splice site probably benign
R8873:Dnah5 UTSW 15 28,219,188 (GRCm38) missense probably benign
R8885:Dnah5 UTSW 15 28,327,740 (GRCm38) missense probably damaging 1.00
R8901:Dnah5 UTSW 15 28,365,569 (GRCm38) missense possibly damaging 0.76
R9025:Dnah5 UTSW 15 28,409,266 (GRCm38) missense probably damaging 1.00
R9037:Dnah5 UTSW 15 28,247,958 (GRCm38) missense probably benign 0.05
R9057:Dnah5 UTSW 15 28,390,868 (GRCm38) missense probably damaging 1.00
R9059:Dnah5 UTSW 15 28,245,666 (GRCm38) missense probably benign
R9065:Dnah5 UTSW 15 28,293,790 (GRCm38) missense probably benign 0.09
R9098:Dnah5 UTSW 15 28,419,961 (GRCm38) missense
R9118:Dnah5 UTSW 15 28,401,848 (GRCm38) frame shift probably null
R9149:Dnah5 UTSW 15 28,387,768 (GRCm38) missense probably benign 0.00
R9184:Dnah5 UTSW 15 28,340,406 (GRCm38) missense probably benign 0.13
R9205:Dnah5 UTSW 15 28,448,334 (GRCm38) missense possibly damaging 0.88
R9297:Dnah5 UTSW 15 28,203,908 (GRCm38) start gained probably benign
R9302:Dnah5 UTSW 15 28,239,886 (GRCm38) missense probably benign 0.03
R9310:Dnah5 UTSW 15 28,448,433 (GRCm38) missense probably damaging 1.00
R9318:Dnah5 UTSW 15 28,203,908 (GRCm38) start gained probably benign
R9405:Dnah5 UTSW 15 28,272,160 (GRCm38) missense probably benign
R9424:Dnah5 UTSW 15 28,272,140 (GRCm38) missense probably benign 0.01
R9467:Dnah5 UTSW 15 28,366,147 (GRCm38) missense possibly damaging 0.94
R9469:Dnah5 UTSW 15 28,421,000 (GRCm38) missense probably benign 0.06
R9548:Dnah5 UTSW 15 28,327,879 (GRCm38) missense possibly damaging 0.79
R9564:Dnah5 UTSW 15 28,290,276 (GRCm38) missense probably benign 0.04
R9576:Dnah5 UTSW 15 28,272,140 (GRCm38) missense probably benign 0.01
R9593:Dnah5 UTSW 15 28,236,628 (GRCm38) missense probably benign
R9644:Dnah5 UTSW 15 28,230,504 (GRCm38) missense probably damaging 0.98
R9655:Dnah5 UTSW 15 28,242,754 (GRCm38) missense probably benign
R9657:Dnah5 UTSW 15 28,409,943 (GRCm38) missense probably damaging 1.00
R9704:Dnah5 UTSW 15 28,247,819 (GRCm38) missense probably benign 0.00
R9797:Dnah5 UTSW 15 28,233,170 (GRCm38) missense probably benign 0.34
RF009:Dnah5 UTSW 15 28,204,019 (GRCm38) missense probably benign 0.00
X0011:Dnah5 UTSW 15 28,408,381 (GRCm38) missense probably benign 0.16
X0018:Dnah5 UTSW 15 28,269,354 (GRCm38) missense probably benign 0.00
X0022:Dnah5 UTSW 15 28,270,411 (GRCm38) missense probably benign 0.01
X0023:Dnah5 UTSW 15 28,384,308 (GRCm38) missense probably damaging 0.99
X0028:Dnah5 UTSW 15 28,470,477 (GRCm38) missense probably damaging 1.00
Z1088:Dnah5 UTSW 15 28,366,357 (GRCm38) missense probably null 0.10
Z1088:Dnah5 UTSW 15 28,384,230 (GRCm38) missense probably damaging 1.00
Z1177:Dnah5 UTSW 15 28,295,311 (GRCm38) missense probably damaging 0.98
Z1177:Dnah5 UTSW 15 28,270,403 (GRCm38) missense probably benign 0.00
Z1177:Dnah5 UTSW 15 28,270,354 (GRCm38) missense probably benign 0.32
Z1177:Dnah5 UTSW 15 28,387,763 (GRCm38) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ATGCTTCTTTGAATTAATGGCTCCC -3'
(R):5'- TTTCCACCGAGCAGGGATTC -3'

Sequencing Primer
(F):5'- GGGCTGGTCTTATAAAAGATACTTG -3'
(R):5'- CAGGGATTCTGGCATCAAACATG -3'
Posted On 2020-09-15