Incidental Mutation 'R7920:Scrt1'
ID 648311
Institutional Source Beutler Lab
Gene Symbol Scrt1
Ensembl Gene ENSMUSG00000048385
Gene Name scratch family zinc finger 1
Synonyms
MMRRC Submission 045967-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.651) question?
Stock # R7920 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 76400403-76406329 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 76403417 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 191 (H191L)
Ref Sequence ENSEMBL: ENSMUSP00000094093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096365] [ENSMUST00000164703]
AlphaFold Q99M85
Predicted Effect unknown
Transcript: ENSMUST00000096365
AA Change: H191L
SMART Domains Protein: ENSMUSP00000094093
Gene: ENSMUSG00000048385
AA Change: H191L

DomainStartEndE-ValueType
low complexity region 78 92 N/A INTRINSIC
ZnF_C2H2 191 213 9.58e-3 SMART
ZnF_C2H2 222 244 5.06e-2 SMART
ZnF_C2H2 248 270 6.42e-4 SMART
ZnF_C2H2 276 298 7.9e-4 SMART
ZnF_C2H2 304 324 3.47e1 SMART
low complexity region 330 341 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000164703
AA Change: H191L
SMART Domains Protein: ENSMUSP00000131152
Gene: ENSMUSG00000048385
AA Change: H191L

DomainStartEndE-ValueType
low complexity region 78 92 N/A INTRINSIC
ZnF_C2H2 191 213 9.58e-3 SMART
ZnF_C2H2 222 244 5.06e-2 SMART
ZnF_C2H2 248 270 6.42e-4 SMART
ZnF_C2H2 276 298 7.9e-4 SMART
ZnF_C2H2 304 324 3.47e1 SMART
low complexity region 330 341 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger transcriptional repressor that binds to E-box motifs. The encoded protein may promote neural differention and may be involved in cancers with neuroendocrine features. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 41,818,130 (GRCm39) S9P probably damaging Het
AI661453 A T 17: 47,779,331 (GRCm39) Q1019L unknown Het
Aldh1a1 T A 19: 20,595,301 (GRCm39) W77R probably damaging Het
Cc2d2a T C 5: 43,896,651 (GRCm39) I1516T probably benign Het
Ccdc149 T A 5: 52,562,436 (GRCm39) I197F probably damaging Het
Cfap119 A G 7: 127,187,125 (GRCm39) M46T probably benign Het
Cfb A G 17: 35,079,867 (GRCm39) V176A probably benign Het
Chordc1 A G 9: 18,213,397 (GRCm39) K83E probably benign Het
Cic G A 7: 24,971,384 (GRCm39) V372M probably benign Het
Coq2 T A 5: 100,811,741 (GRCm39) probably benign Het
Cradd A G 10: 95,158,573 (GRCm39) L58P probably damaging Het
Crim1 A T 17: 78,610,493 (GRCm39) D316V probably damaging Het
Cyb5rl C A 4: 106,928,205 (GRCm39) L114I possibly damaging Het
Cyp2c69 T G 19: 39,866,247 (GRCm39) probably null Het
Ddhd1 A G 14: 45,894,927 (GRCm39) F181S probably damaging Het
Dennd1b G A 1: 138,990,611 (GRCm39) E192K probably damaging Het
Dmrt1 T C 19: 25,483,383 (GRCm39) S56P possibly damaging Het
Dnah12 A G 14: 26,578,499 (GRCm39) E3086G possibly damaging Het
Dnah5 A T 15: 28,453,368 (GRCm39) M4380L probably benign Het
Dph7 A T 2: 24,861,624 (GRCm39) M346L probably benign Het
Eef1ece2 A G 16: 20,456,442 (GRCm39) E428G possibly damaging Het
Egf C T 3: 129,529,489 (GRCm39) R307H probably benign Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Fcna T C 2: 25,516,298 (GRCm39) K112E probably benign Het
Fkbp5 A T 17: 28,648,213 (GRCm39) N125K possibly damaging Het
Foxo3 C T 10: 42,073,765 (GRCm39) V251I possibly damaging Het
Fryl T A 5: 73,259,150 (GRCm39) probably null Het
Fsip2 A G 2: 82,781,365 (GRCm39) E253G possibly damaging Het
Gprc6a T A 10: 51,491,026 (GRCm39) T908S probably benign Het
Grin2c A T 11: 115,144,970 (GRCm39) F560L probably benign Het
Hao1 T A 2: 134,390,172 (GRCm39) N56Y probably damaging Het
Haus3 T C 5: 34,325,046 (GRCm39) I204M probably benign Het
Htr3b C A 9: 48,848,456 (GRCm39) C263F probably damaging Het
Ica1 A T 6: 8,742,274 (GRCm39) C120S probably benign Het
Inpp4a T A 1: 37,406,886 (GRCm39) S210T probably benign Het
Inpp5d T G 1: 87,633,671 (GRCm39) I699S probably damaging Het
Kcng1 A G 2: 168,104,904 (GRCm39) V314A probably benign Het
Lcn11 G A 2: 25,669,343 (GRCm39) V167M possibly damaging Het
Lingo3 C A 10: 80,670,382 (GRCm39) R516L probably benign Het
Lrmda T C 14: 22,646,546 (GRCm39) V151A probably damaging Het
Ly6g5b A C 17: 35,333,578 (GRCm39) I133R probably damaging Het
Mcidas G A 13: 113,135,521 (GRCm39) G315S probably damaging Het
Miip C T 4: 147,947,375 (GRCm39) G236S probably benign Het
Mroh7 T C 4: 106,564,773 (GRCm39) T562A probably benign Het
Nlrc4 A G 17: 74,734,114 (GRCm39) M933T probably benign Het
Or13a25 A T 7: 140,247,814 (GRCm39) S198C possibly damaging Het
Pkhd1 A T 1: 20,345,759 (GRCm39) D2756E probably damaging Het
Plekhm2 T C 4: 141,359,432 (GRCm39) D445G probably damaging Het
Ppp1r12c C T 7: 4,486,354 (GRCm39) G605D probably benign Het
Pygb T A 2: 150,628,922 (GRCm39) N45K possibly damaging Het
Scn4b A G 9: 45,058,069 (GRCm39) T54A probably damaging Het
Sdc3 A G 4: 130,546,507 (GRCm39) M289V probably benign Het
Shb C T 4: 45,489,054 (GRCm39) probably null Het
Slc1a5 A G 7: 16,527,795 (GRCm39) T364A probably damaging Het
Slc25a27 A G 17: 43,960,564 (GRCm39) V218A probably benign Het
Slc39a4 C T 15: 76,498,285 (GRCm39) G384D probably damaging Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Styxl2 T A 1: 165,927,465 (GRCm39) N716Y possibly damaging Het
Tmem67 A T 4: 12,089,284 (GRCm39) probably null Het
Tonsl C T 15: 76,518,787 (GRCm39) R544H probably damaging Het
Trex1 A G 9: 108,887,157 (GRCm39) V278A unknown Het
Ttn A T 2: 76,625,501 (GRCm39) D15107E probably damaging Het
Tubgcp5 A G 7: 55,466,310 (GRCm39) T621A probably benign Het
Zfhx4 T C 3: 5,465,515 (GRCm39) V1916A possibly damaging Het
Zfp260 A T 7: 29,805,017 (GRCm39) K306* probably null Het
Zkscan7 A T 9: 122,724,974 (GRCm39) T648S probably benign Het
Zscan4c T A 7: 10,743,699 (GRCm39) F433I possibly damaging Het
Other mutations in Scrt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Scrt1 APN 15 76,403,150 (GRCm39) missense unknown
R4676:Scrt1 UTSW 15 76,405,868 (GRCm39) missense possibly damaging 0.92
R5321:Scrt1 UTSW 15 76,403,370 (GRCm39) missense unknown
R5679:Scrt1 UTSW 15 76,403,262 (GRCm39) missense unknown
R7591:Scrt1 UTSW 15 76,403,694 (GRCm39) missense probably damaging 1.00
R8558:Scrt1 UTSW 15 76,403,843 (GRCm39) nonsense probably null
R8804:Scrt1 UTSW 15 76,403,411 (GRCm39) missense unknown
R8846:Scrt1 UTSW 15 76,405,808 (GRCm39) missense possibly damaging 0.84
R9507:Scrt1 UTSW 15 76,403,292 (GRCm39) missense unknown
Z1177:Scrt1 UTSW 15 76,403,114 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TTGAGATAAGACTTGAGCGCG -3'
(R):5'- TTCTTCATCACTGACGGGC -3'

Sequencing Primer
(F):5'- GAAGCTCTTCTTGCAGCGC -3'
(R):5'- TGCTAATGCCAACGCTGC -3'
Posted On 2020-09-15