Mutagenetix > Incidental Mutation

Incidental Mutation 'R7920:Crim1'

648321

Institutional Source

Beutler Lab

Gene Symbol

Crim1

Ensembl Gene

ENSMUSG00000024074

Gene Name

cysteine rich transmembrane BMP regulator 1 (chordin like)

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7920 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78200248-78376592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 78303064 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 316 (D316V)

Ref Sequence

ENSEMBL: ENSMUSP00000108117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112498]

AlphaFold

Q9JLL0

Predicted Effect

probably damaging
Transcript: ENSMUST00000112498
AA Change: D316V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: D316V

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
IB	35	111	1.87e-5	SMART
VWC	336	390	6.04e-13	SMART
VWC	403	456	1.15e-9	SMART
Pfam:Antistasin	469	498	4.5e-10	PFAM
Pfam:Antistasin	505	532	1.5e-8	PFAM
Pfam:Antistasin	539	564	5.7e-9	PFAM
Pfam:Antistasin	567	592	1.7e-10	PFAM
VWC	608	662	1.26e-10	SMART
VWC	679	734	1.37e-11	SMART
VWC	753	808	1.46e-11	SMART
VWC	819	873	1.01e-14	SMART
transmembrane domain	940	962	N/A	INTRINSIC

Meta Mutation Damage Score

0.5127

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024B05Rik	T	C	14: 41,996,173	S9P	probably damaging	Het
AI661453	A	T	17: 47,468,406	Q1019L	unknown	Het
Aldh1a1	T	A	19: 20,617,937	W77R	probably damaging	Het
Cc2d2a	T	C	5: 43,739,309	I1516T	probably benign	Het
Ccdc149	T	A	5: 52,405,094	I197F	probably damaging	Het
Ccdc189	A	G	7: 127,587,953	M46T	probably benign	Het
Cfb	A	G	17: 34,860,891	V176A	probably benign	Het
Chordc1	A	G	9: 18,302,101	K83E	probably benign	Het
Cic	G	A	7: 25,271,959	V372M	probably benign	Het
Coq2	T	A	5: 100,663,875		probably benign	Het
Cradd	A	G	10: 95,322,711	L58P	probably damaging	Het
Cyb5rl	C	A	4: 107,071,008	L114I	possibly damaging	Het
Cyp2c69	T	G	19: 39,877,803		probably null	Het
Ddhd1	A	G	14: 45,657,470	F181S	probably damaging	Het
Dennd1b	G	A	1: 139,062,873	E192K	probably damaging	Het
Dmrt1	T	C	19: 25,506,019	S56P	possibly damaging	Het
Dnah12	A	G	14: 26,856,542	E3086G	possibly damaging	Het
Dnah5	A	T	15: 28,453,222	M4380L	probably benign	Het
Dph7	A	T	2: 24,971,612	M346L	probably benign	Het
Dusp27	T	A	1: 166,099,896	N716Y	possibly damaging	Het
Egf	C	T	3: 129,735,840	R307H	probably benign	Het
Fam50b	G	A	13: 34,747,101	E187K	possibly damaging	Het
Fcna	T	C	2: 25,626,286	K112E	probably benign	Het
Fkbp5	A	T	17: 28,429,239	N125K	possibly damaging	Het
Foxo3	C	T	10: 42,197,769	V251I	possibly damaging	Het
Fryl	T	A	5: 73,101,807		probably null	Het
Fsip2	A	G	2: 82,951,021	E253G	possibly damaging	Het
Gm49333	A	G	16: 20,637,692	E428G	possibly damaging	Het
Gprc6a	T	A	10: 51,614,930	T908S	probably benign	Het
Grin2c	A	T	11: 115,254,144	F560L	probably benign	Het
Hao1	T	A	2: 134,548,252	N56Y	probably damaging	Het
Haus3	T	C	5: 34,167,702	I204M	probably benign	Het
Htr3b	C	A	9: 48,937,156	C263F	probably damaging	Het
Ica1	A	T	6: 8,742,274	C120S	probably benign	Het
Inpp4a	T	A	1: 37,367,805	S210T	probably benign	Het
Inpp5d	T	G	1: 87,705,949	I699S	probably damaging	Het
Kcng1	A	G	2: 168,262,984	V314A	probably benign	Het
Lcn11	G	A	2: 25,779,331	V167M	possibly damaging	Het
Lingo3	C	A	10: 80,834,548	R516L	probably benign	Het
Lrmda	T	C	14: 22,596,478	V151A	probably damaging	Het
Ly6g5b	A	C	17: 35,114,602	I133R	probably damaging	Het
Mcidas	G	A	13: 112,998,987	G315S	probably damaging	Het
Miip	C	T	4: 147,862,918	G236S	probably benign	Het
Mroh7	T	C	4: 106,707,576	T562A	probably benign	Het
Nlrc4	A	G	17: 74,427,119	M933T	probably benign	Het
Olfr539	A	T	7: 140,667,901	S198C	possibly damaging	Het
Pkhd1	A	T	1: 20,275,535	D2756E	probably damaging	Het
Plekhm2	T	C	4: 141,632,121	D445G	probably damaging	Het
Ppp1r12c	C	T	7: 4,483,355	G605D	probably benign	Het
Pygb	T	A	2: 150,787,002	N45K	possibly damaging	Het
Scn4b	A	G	9: 45,146,771	T54A	probably damaging	Het
Scrt1	T	A	15: 76,519,217	H191L	unknown	Het
Sdc3	A	G	4: 130,819,196	M289V	probably benign	Het
Shb	C	T	4: 45,489,054		probably null	Het
Slc1a5	A	G	7: 16,793,870	T364A	probably damaging	Het
Slc25a27	A	G	17: 43,649,673	V218A	probably benign	Het
Slc39a4	C	T	15: 76,614,085	G384D	probably damaging	Het
Sptbn2	C	G	19: 4,749,012	R2037G	probably benign	Het
Tmem67	A	T	4: 12,089,284		probably null	Het
Tonsl	C	T	15: 76,634,587	R544H	probably damaging	Het
Trex1	A	G	9: 109,058,089	V278A	unknown	Het
Ttn	A	T	2: 76,795,157	D15107E	probably damaging	Het
Tubgcp5	A	G	7: 55,816,562	T621A	probably benign	Het
Zfhx4	T	C	3: 5,400,455	V1916A	possibly damaging	Het
Zfp260	A	T	7: 30,105,592	K306*	probably null	Het
Zkscan7	A	T	9: 122,895,909	T648S	probably benign	Het
Zscan4c	T	A	7: 11,009,772	F433I	possibly damaging	Het

Other mutations in Crim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Crim1	APN	17	78370091	missense	probably damaging	1.00
IGL01090:Crim1	APN	17	78347229	missense	probably damaging	0.97
IGL01490:Crim1	APN	17	78335296	missense	possibly damaging	0.94
IGL01686:Crim1	APN	17	78344434	missense	probably benign	0.09
IGL01769:Crim1	APN	17	78313235	missense	probably benign	0.02
IGL02004:Crim1	APN	17	78372575	splice site	probably benign
IGL02211:Crim1	APN	17	78355145	missense	probably damaging	1.00
IGL02275:Crim1	APN	17	78369998	missense	possibly damaging	0.56
IGL02408:Crim1	APN	17	78315654	missense	possibly damaging	0.78
IGL02411:Crim1	APN	17	78335334	nonsense	probably null
IGL02453:Crim1	APN	17	78344484	missense	probably damaging	1.00
IGL02481:Crim1	APN	17	78350798	missense	probably damaging	0.98
IGL02632:Crim1	APN	17	78372674	missense	probably benign	0.08
IGL02652:Crim1	APN	17	78315677	missense	probably damaging	1.00
IGL02696:Crim1	APN	17	78279973	missense	probably damaging	0.96
IGL02811:Crim1	APN	17	78350701	missense	possibly damaging	0.62
IGL03105:Crim1	APN	17	78315750	splice site	probably benign
IGL03349:Crim1	APN	17	78355150	nonsense	probably null
bugeye	UTSW	17	78281347	missense	possibly damaging	0.94
IGL03097:Crim1	UTSW	17	78367798	missense	probably benign	0.00
R0227:Crim1	UTSW	17	78344509	splice site	probably benign
R0458:Crim1	UTSW	17	78313226	missense	probably damaging	0.98
R0482:Crim1	UTSW	17	78372579	missense	probably benign	0.00
R0989:Crim1	UTSW	17	78200944	missense	probably benign	0.21
R1266:Crim1	UTSW	17	78200833	small deletion	probably benign
R1529:Crim1	UTSW	17	78367954	missense	probably benign
R1679:Crim1	UTSW	17	78200799	missense	probably benign	0.27
R1909:Crim1	UTSW	17	78313127	missense	probably benign	0.26
R2273:Crim1	UTSW	17	78355179	critical splice donor site	probably null
R3899:Crim1	UTSW	17	78281354	missense	probably benign	0.00
R3909:Crim1	UTSW	17	78281239	splice site	probably benign
R4092:Crim1	UTSW	17	78350836	missense	probably damaging	1.00
R4154:Crim1	UTSW	17	78237843	missense	probably benign	0.01
R4687:Crim1	UTSW	17	78303025	missense	probably damaging	1.00
R5022:Crim1	UTSW	17	78280129	missense	possibly damaging	0.95
R5073:Crim1	UTSW	17	78281347	missense	possibly damaging	0.94
R5089:Crim1	UTSW	17	78374090	missense	probably damaging	1.00
R5284:Crim1	UTSW	17	78313266	missense	possibly damaging	0.83
R5461:Crim1	UTSW	17	78237807	missense	probably damaging	1.00
R5635:Crim1	UTSW	17	78315641	missense	probably damaging	1.00
R5686:Crim1	UTSW	17	78374083	missense	possibly damaging	0.63
R5956:Crim1	UTSW	17	78315717	missense	probably damaging	1.00
R6117:Crim1	UTSW	17	78303088	missense	probably damaging	1.00
R6129:Crim1	UTSW	17	78281309	missense	probably benign	0.17
R6265:Crim1	UTSW	17	78370085	missense	probably benign	0.01
R6812:Crim1	UTSW	17	78315600	missense	probably damaging	1.00
R6858:Crim1	UTSW	17	78315627	missense	probably damaging	1.00
R8022:Crim1	UTSW	17	78315555	missense	possibly damaging	0.82
R8434:Crim1	UTSW	17	78347257	missense	probably benign	0.00
R8782:Crim1	UTSW	17	78200877	missense	probably damaging	1.00
R8961:Crim1	UTSW	17	78372688	missense	possibly damaging	0.65
R8971:Crim1	UTSW	17	78345980	missense	possibly damaging	0.89
R9245:Crim1	UTSW	17	78344442	missense	probably damaging	1.00
R9250:Crim1	UTSW	17	78370042	missense	probably benign
R9401:Crim1	UTSW	17	78350865	frame shift	probably null
R9402:Crim1	UTSW	17	78350865	frame shift	probably null
R9644:Crim1	UTSW	17	78280068	missense	probably damaging	1.00
R9702:Crim1	UTSW	17	78374087	missense	probably damaging	1.00
R9710:Crim1	UTSW	17	78303075	nonsense	probably null
X0064:Crim1	UTSW	17	78200833	small deletion	probably benign
Z1088:Crim1	UTSW	17	78367835	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- TTACTAGCACAACCGTTCCC -3'
(R):5'- CTGAGTGATCTTCAGCATGGCC -3'

Sequencing Primer
(F):5'- TACCAGGTAACCAGGTTGTATCACG -3'
(R):5'- TCAGCATGGCCCTAAGTATG -3'

Posted On

2020-09-15