Incidental Mutation 'R7920:Crim1'
ID 648321
Institutional Source Beutler Lab
Gene Symbol Crim1
Ensembl Gene ENSMUSG00000024074
Gene Name cysteine rich transmembrane BMP regulator 1
Synonyms
MMRRC Submission 045967-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7920 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 78507677-78684021 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78610493 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 316 (D316V)
Ref Sequence ENSEMBL: ENSMUSP00000108117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112498]
AlphaFold Q9JLL0
Predicted Effect probably damaging
Transcript: ENSMUST00000112498
AA Change: D316V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: D316V

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 35 111 1.87e-5 SMART
VWC 336 390 6.04e-13 SMART
VWC 403 456 1.15e-9 SMART
Pfam:Antistasin 469 498 4.5e-10 PFAM
Pfam:Antistasin 505 532 1.5e-8 PFAM
Pfam:Antistasin 539 564 5.7e-9 PFAM
Pfam:Antistasin 567 592 1.7e-10 PFAM
VWC 608 662 1.26e-10 SMART
VWC 679 734 1.37e-11 SMART
VWC 753 808 1.46e-11 SMART
VWC 819 873 1.01e-14 SMART
transmembrane domain 940 962 N/A INTRINSIC
Meta Mutation Damage Score 0.5127 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 41,818,130 (GRCm39) S9P probably damaging Het
AI661453 A T 17: 47,779,331 (GRCm39) Q1019L unknown Het
Aldh1a1 T A 19: 20,595,301 (GRCm39) W77R probably damaging Het
Cc2d2a T C 5: 43,896,651 (GRCm39) I1516T probably benign Het
Ccdc149 T A 5: 52,562,436 (GRCm39) I197F probably damaging Het
Cfap119 A G 7: 127,187,125 (GRCm39) M46T probably benign Het
Cfb A G 17: 35,079,867 (GRCm39) V176A probably benign Het
Chordc1 A G 9: 18,213,397 (GRCm39) K83E probably benign Het
Cic G A 7: 24,971,384 (GRCm39) V372M probably benign Het
Coq2 T A 5: 100,811,741 (GRCm39) probably benign Het
Cradd A G 10: 95,158,573 (GRCm39) L58P probably damaging Het
Cyb5rl C A 4: 106,928,205 (GRCm39) L114I possibly damaging Het
Cyp2c69 T G 19: 39,866,247 (GRCm39) probably null Het
Ddhd1 A G 14: 45,894,927 (GRCm39) F181S probably damaging Het
Dennd1b G A 1: 138,990,611 (GRCm39) E192K probably damaging Het
Dmrt1 T C 19: 25,483,383 (GRCm39) S56P possibly damaging Het
Dnah12 A G 14: 26,578,499 (GRCm39) E3086G possibly damaging Het
Dnah5 A T 15: 28,453,368 (GRCm39) M4380L probably benign Het
Dph7 A T 2: 24,861,624 (GRCm39) M346L probably benign Het
Eef1ece2 A G 16: 20,456,442 (GRCm39) E428G possibly damaging Het
Egf C T 3: 129,529,489 (GRCm39) R307H probably benign Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Fcna T C 2: 25,516,298 (GRCm39) K112E probably benign Het
Fkbp5 A T 17: 28,648,213 (GRCm39) N125K possibly damaging Het
Foxo3 C T 10: 42,073,765 (GRCm39) V251I possibly damaging Het
Fryl T A 5: 73,259,150 (GRCm39) probably null Het
Fsip2 A G 2: 82,781,365 (GRCm39) E253G possibly damaging Het
Gprc6a T A 10: 51,491,026 (GRCm39) T908S probably benign Het
Grin2c A T 11: 115,144,970 (GRCm39) F560L probably benign Het
Hao1 T A 2: 134,390,172 (GRCm39) N56Y probably damaging Het
Haus3 T C 5: 34,325,046 (GRCm39) I204M probably benign Het
Htr3b C A 9: 48,848,456 (GRCm39) C263F probably damaging Het
Ica1 A T 6: 8,742,274 (GRCm39) C120S probably benign Het
Inpp4a T A 1: 37,406,886 (GRCm39) S210T probably benign Het
Inpp5d T G 1: 87,633,671 (GRCm39) I699S probably damaging Het
Kcng1 A G 2: 168,104,904 (GRCm39) V314A probably benign Het
Lcn11 G A 2: 25,669,343 (GRCm39) V167M possibly damaging Het
Lingo3 C A 10: 80,670,382 (GRCm39) R516L probably benign Het
Lrmda T C 14: 22,646,546 (GRCm39) V151A probably damaging Het
Ly6g5b A C 17: 35,333,578 (GRCm39) I133R probably damaging Het
Mcidas G A 13: 113,135,521 (GRCm39) G315S probably damaging Het
Miip C T 4: 147,947,375 (GRCm39) G236S probably benign Het
Mroh7 T C 4: 106,564,773 (GRCm39) T562A probably benign Het
Nlrc4 A G 17: 74,734,114 (GRCm39) M933T probably benign Het
Or13a25 A T 7: 140,247,814 (GRCm39) S198C possibly damaging Het
Pkhd1 A T 1: 20,345,759 (GRCm39) D2756E probably damaging Het
Plekhm2 T C 4: 141,359,432 (GRCm39) D445G probably damaging Het
Ppp1r12c C T 7: 4,486,354 (GRCm39) G605D probably benign Het
Pygb T A 2: 150,628,922 (GRCm39) N45K possibly damaging Het
Scn4b A G 9: 45,058,069 (GRCm39) T54A probably damaging Het
Scrt1 T A 15: 76,403,417 (GRCm39) H191L unknown Het
Sdc3 A G 4: 130,546,507 (GRCm39) M289V probably benign Het
Shb C T 4: 45,489,054 (GRCm39) probably null Het
Slc1a5 A G 7: 16,527,795 (GRCm39) T364A probably damaging Het
Slc25a27 A G 17: 43,960,564 (GRCm39) V218A probably benign Het
Slc39a4 C T 15: 76,498,285 (GRCm39) G384D probably damaging Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Styxl2 T A 1: 165,927,465 (GRCm39) N716Y possibly damaging Het
Tmem67 A T 4: 12,089,284 (GRCm39) probably null Het
Tonsl C T 15: 76,518,787 (GRCm39) R544H probably damaging Het
Trex1 A G 9: 108,887,157 (GRCm39) V278A unknown Het
Ttn A T 2: 76,625,501 (GRCm39) D15107E probably damaging Het
Tubgcp5 A G 7: 55,466,310 (GRCm39) T621A probably benign Het
Zfhx4 T C 3: 5,465,515 (GRCm39) V1916A possibly damaging Het
Zfp260 A T 7: 29,805,017 (GRCm39) K306* probably null Het
Zkscan7 A T 9: 122,724,974 (GRCm39) T648S probably benign Het
Zscan4c T A 7: 10,743,699 (GRCm39) F433I possibly damaging Het
Other mutations in Crim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Crim1 APN 17 78,677,520 (GRCm39) missense probably damaging 1.00
IGL01090:Crim1 APN 17 78,654,658 (GRCm39) missense probably damaging 0.97
IGL01490:Crim1 APN 17 78,642,725 (GRCm39) missense possibly damaging 0.94
IGL01686:Crim1 APN 17 78,651,863 (GRCm39) missense probably benign 0.09
IGL01769:Crim1 APN 17 78,620,664 (GRCm39) missense probably benign 0.02
IGL02004:Crim1 APN 17 78,680,004 (GRCm39) splice site probably benign
IGL02211:Crim1 APN 17 78,662,574 (GRCm39) missense probably damaging 1.00
IGL02275:Crim1 APN 17 78,677,427 (GRCm39) missense possibly damaging 0.56
IGL02408:Crim1 APN 17 78,623,083 (GRCm39) missense possibly damaging 0.78
IGL02411:Crim1 APN 17 78,642,763 (GRCm39) nonsense probably null
IGL02453:Crim1 APN 17 78,651,913 (GRCm39) missense probably damaging 1.00
IGL02481:Crim1 APN 17 78,658,227 (GRCm39) missense probably damaging 0.98
IGL02632:Crim1 APN 17 78,680,103 (GRCm39) missense probably benign 0.08
IGL02652:Crim1 APN 17 78,623,106 (GRCm39) missense probably damaging 1.00
IGL02696:Crim1 APN 17 78,587,402 (GRCm39) missense probably damaging 0.96
IGL02811:Crim1 APN 17 78,658,130 (GRCm39) missense possibly damaging 0.62
IGL03105:Crim1 APN 17 78,623,179 (GRCm39) splice site probably benign
IGL03349:Crim1 APN 17 78,662,579 (GRCm39) nonsense probably null
bugeye UTSW 17 78,588,776 (GRCm39) missense possibly damaging 0.94
IGL03097:Crim1 UTSW 17 78,675,227 (GRCm39) missense probably benign 0.00
R0227:Crim1 UTSW 17 78,651,938 (GRCm39) splice site probably benign
R0458:Crim1 UTSW 17 78,620,655 (GRCm39) missense probably damaging 0.98
R0482:Crim1 UTSW 17 78,680,008 (GRCm39) missense probably benign 0.00
R0989:Crim1 UTSW 17 78,508,373 (GRCm39) missense probably benign 0.21
R1266:Crim1 UTSW 17 78,508,262 (GRCm39) small deletion probably benign
R1529:Crim1 UTSW 17 78,675,383 (GRCm39) missense probably benign
R1679:Crim1 UTSW 17 78,508,228 (GRCm39) missense probably benign 0.27
R1909:Crim1 UTSW 17 78,620,556 (GRCm39) missense probably benign 0.26
R2273:Crim1 UTSW 17 78,662,608 (GRCm39) critical splice donor site probably null
R3899:Crim1 UTSW 17 78,588,783 (GRCm39) missense probably benign 0.00
R3909:Crim1 UTSW 17 78,588,668 (GRCm39) splice site probably benign
R4092:Crim1 UTSW 17 78,658,265 (GRCm39) missense probably damaging 1.00
R4154:Crim1 UTSW 17 78,545,272 (GRCm39) missense probably benign 0.01
R4687:Crim1 UTSW 17 78,610,454 (GRCm39) missense probably damaging 1.00
R5022:Crim1 UTSW 17 78,587,558 (GRCm39) missense possibly damaging 0.95
R5073:Crim1 UTSW 17 78,588,776 (GRCm39) missense possibly damaging 0.94
R5089:Crim1 UTSW 17 78,681,519 (GRCm39) missense probably damaging 1.00
R5284:Crim1 UTSW 17 78,620,695 (GRCm39) missense possibly damaging 0.83
R5461:Crim1 UTSW 17 78,545,236 (GRCm39) missense probably damaging 1.00
R5635:Crim1 UTSW 17 78,623,070 (GRCm39) missense probably damaging 1.00
R5686:Crim1 UTSW 17 78,681,512 (GRCm39) missense possibly damaging 0.63
R5956:Crim1 UTSW 17 78,623,146 (GRCm39) missense probably damaging 1.00
R6117:Crim1 UTSW 17 78,610,517 (GRCm39) missense probably damaging 1.00
R6129:Crim1 UTSW 17 78,588,738 (GRCm39) missense probably benign 0.17
R6265:Crim1 UTSW 17 78,677,514 (GRCm39) missense probably benign 0.01
R6812:Crim1 UTSW 17 78,623,029 (GRCm39) missense probably damaging 1.00
R6858:Crim1 UTSW 17 78,623,056 (GRCm39) missense probably damaging 1.00
R8022:Crim1 UTSW 17 78,622,984 (GRCm39) missense possibly damaging 0.82
R8434:Crim1 UTSW 17 78,654,686 (GRCm39) missense probably benign 0.00
R8782:Crim1 UTSW 17 78,508,306 (GRCm39) missense probably damaging 1.00
R8961:Crim1 UTSW 17 78,680,117 (GRCm39) missense possibly damaging 0.65
R8971:Crim1 UTSW 17 78,653,409 (GRCm39) missense possibly damaging 0.89
R9245:Crim1 UTSW 17 78,651,871 (GRCm39) missense probably damaging 1.00
R9250:Crim1 UTSW 17 78,677,471 (GRCm39) missense probably benign
R9401:Crim1 UTSW 17 78,658,294 (GRCm39) frame shift probably null
R9402:Crim1 UTSW 17 78,658,294 (GRCm39) frame shift probably null
R9644:Crim1 UTSW 17 78,587,497 (GRCm39) missense probably damaging 1.00
R9702:Crim1 UTSW 17 78,681,516 (GRCm39) missense probably damaging 1.00
R9710:Crim1 UTSW 17 78,610,504 (GRCm39) nonsense probably null
X0064:Crim1 UTSW 17 78,508,262 (GRCm39) small deletion probably benign
Z1088:Crim1 UTSW 17 78,675,264 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTACTAGCACAACCGTTCCC -3'
(R):5'- CTGAGTGATCTTCAGCATGGCC -3'

Sequencing Primer
(F):5'- TACCAGGTAACCAGGTTGTATCACG -3'
(R):5'- TCAGCATGGCCCTAAGTATG -3'
Posted On 2020-09-15