Incidental Mutation 'R7920:Crim1'
ID 648321
Institutional Source Beutler Lab
Gene Symbol Crim1
Ensembl Gene ENSMUSG00000024074
Gene Name cysteine rich transmembrane BMP regulator 1 (chordin like)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7920 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 78200248-78376592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78303064 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 316 (D316V)
Ref Sequence ENSEMBL: ENSMUSP00000108117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112498]
AlphaFold Q9JLL0
Predicted Effect probably damaging
Transcript: ENSMUST00000112498
AA Change: D316V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: D316V

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 35 111 1.87e-5 SMART
VWC 336 390 6.04e-13 SMART
VWC 403 456 1.15e-9 SMART
Pfam:Antistasin 469 498 4.5e-10 PFAM
Pfam:Antistasin 505 532 1.5e-8 PFAM
Pfam:Antistasin 539 564 5.7e-9 PFAM
Pfam:Antistasin 567 592 1.7e-10 PFAM
VWC 608 662 1.26e-10 SMART
VWC 679 734 1.37e-11 SMART
VWC 753 808 1.46e-11 SMART
VWC 819 873 1.01e-14 SMART
transmembrane domain 940 962 N/A INTRINSIC
Meta Mutation Damage Score 0.5127 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik T C 14: 41,996,173 S9P probably damaging Het
AI661453 A T 17: 47,468,406 Q1019L unknown Het
Aldh1a1 T A 19: 20,617,937 W77R probably damaging Het
Cc2d2a T C 5: 43,739,309 I1516T probably benign Het
Ccdc149 T A 5: 52,405,094 I197F probably damaging Het
Ccdc189 A G 7: 127,587,953 M46T probably benign Het
Cfb A G 17: 34,860,891 V176A probably benign Het
Chordc1 A G 9: 18,302,101 K83E probably benign Het
Cic G A 7: 25,271,959 V372M probably benign Het
Coq2 T A 5: 100,663,875 probably benign Het
Cradd A G 10: 95,322,711 L58P probably damaging Het
Cyb5rl C A 4: 107,071,008 L114I possibly damaging Het
Cyp2c69 T G 19: 39,877,803 probably null Het
Ddhd1 A G 14: 45,657,470 F181S probably damaging Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dmrt1 T C 19: 25,506,019 S56P possibly damaging Het
Dnah12 A G 14: 26,856,542 E3086G possibly damaging Het
Dnah5 A T 15: 28,453,222 M4380L probably benign Het
Dph7 A T 2: 24,971,612 M346L probably benign Het
Dusp27 T A 1: 166,099,896 N716Y possibly damaging Het
Egf C T 3: 129,735,840 R307H probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fcna T C 2: 25,626,286 K112E probably benign Het
Fkbp5 A T 17: 28,429,239 N125K possibly damaging Het
Foxo3 C T 10: 42,197,769 V251I possibly damaging Het
Fryl T A 5: 73,101,807 probably null Het
Fsip2 A G 2: 82,951,021 E253G possibly damaging Het
Gm49333 A G 16: 20,637,692 E428G possibly damaging Het
Gprc6a T A 10: 51,614,930 T908S probably benign Het
Grin2c A T 11: 115,254,144 F560L probably benign Het
Hao1 T A 2: 134,548,252 N56Y probably damaging Het
Haus3 T C 5: 34,167,702 I204M probably benign Het
Htr3b C A 9: 48,937,156 C263F probably damaging Het
Ica1 A T 6: 8,742,274 C120S probably benign Het
Inpp4a T A 1: 37,367,805 S210T probably benign Het
Inpp5d T G 1: 87,705,949 I699S probably damaging Het
Kcng1 A G 2: 168,262,984 V314A probably benign Het
Lcn11 G A 2: 25,779,331 V167M possibly damaging Het
Lingo3 C A 10: 80,834,548 R516L probably benign Het
Lrmda T C 14: 22,596,478 V151A probably damaging Het
Ly6g5b A C 17: 35,114,602 I133R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mroh7 T C 4: 106,707,576 T562A probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Olfr539 A T 7: 140,667,901 S198C possibly damaging Het
Pkhd1 A T 1: 20,275,535 D2756E probably damaging Het
Plekhm2 T C 4: 141,632,121 D445G probably damaging Het
Ppp1r12c C T 7: 4,483,355 G605D probably benign Het
Pygb T A 2: 150,787,002 N45K possibly damaging Het
Scn4b A G 9: 45,146,771 T54A probably damaging Het
Scrt1 T A 15: 76,519,217 H191L unknown Het
Sdc3 A G 4: 130,819,196 M289V probably benign Het
Shb C T 4: 45,489,054 probably null Het
Slc1a5 A G 7: 16,793,870 T364A probably damaging Het
Slc25a27 A G 17: 43,649,673 V218A probably benign Het
Slc39a4 C T 15: 76,614,085 G384D probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Tmem67 A T 4: 12,089,284 probably null Het
Tonsl C T 15: 76,634,587 R544H probably damaging Het
Trex1 A G 9: 109,058,089 V278A unknown Het
Ttn A T 2: 76,795,157 D15107E probably damaging Het
Tubgcp5 A G 7: 55,816,562 T621A probably benign Het
Zfhx4 T C 3: 5,400,455 V1916A possibly damaging Het
Zfp260 A T 7: 30,105,592 K306* probably null Het
Zkscan7 A T 9: 122,895,909 T648S probably benign Het
Zscan4c T A 7: 11,009,772 F433I possibly damaging Het
Other mutations in Crim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Crim1 APN 17 78370091 missense probably damaging 1.00
IGL01090:Crim1 APN 17 78347229 missense probably damaging 0.97
IGL01490:Crim1 APN 17 78335296 missense possibly damaging 0.94
IGL01686:Crim1 APN 17 78344434 missense probably benign 0.09
IGL01769:Crim1 APN 17 78313235 missense probably benign 0.02
IGL02004:Crim1 APN 17 78372575 splice site probably benign
IGL02211:Crim1 APN 17 78355145 missense probably damaging 1.00
IGL02275:Crim1 APN 17 78369998 missense possibly damaging 0.56
IGL02408:Crim1 APN 17 78315654 missense possibly damaging 0.78
IGL02411:Crim1 APN 17 78335334 nonsense probably null
IGL02453:Crim1 APN 17 78344484 missense probably damaging 1.00
IGL02481:Crim1 APN 17 78350798 missense probably damaging 0.98
IGL02632:Crim1 APN 17 78372674 missense probably benign 0.08
IGL02652:Crim1 APN 17 78315677 missense probably damaging 1.00
IGL02696:Crim1 APN 17 78279973 missense probably damaging 0.96
IGL02811:Crim1 APN 17 78350701 missense possibly damaging 0.62
IGL03105:Crim1 APN 17 78315750 splice site probably benign
IGL03349:Crim1 APN 17 78355150 nonsense probably null
bugeye UTSW 17 78281347 missense possibly damaging 0.94
IGL03097:Crim1 UTSW 17 78367798 missense probably benign 0.00
R0227:Crim1 UTSW 17 78344509 splice site probably benign
R0458:Crim1 UTSW 17 78313226 missense probably damaging 0.98
R0482:Crim1 UTSW 17 78372579 missense probably benign 0.00
R0989:Crim1 UTSW 17 78200944 missense probably benign 0.21
R1266:Crim1 UTSW 17 78200833 small deletion probably benign
R1529:Crim1 UTSW 17 78367954 missense probably benign
R1679:Crim1 UTSW 17 78200799 missense probably benign 0.27
R1909:Crim1 UTSW 17 78313127 missense probably benign 0.26
R2273:Crim1 UTSW 17 78355179 critical splice donor site probably null
R3899:Crim1 UTSW 17 78281354 missense probably benign 0.00
R3909:Crim1 UTSW 17 78281239 splice site probably benign
R4092:Crim1 UTSW 17 78350836 missense probably damaging 1.00
R4154:Crim1 UTSW 17 78237843 missense probably benign 0.01
R4687:Crim1 UTSW 17 78303025 missense probably damaging 1.00
R5022:Crim1 UTSW 17 78280129 missense possibly damaging 0.95
R5073:Crim1 UTSW 17 78281347 missense possibly damaging 0.94
R5089:Crim1 UTSW 17 78374090 missense probably damaging 1.00
R5284:Crim1 UTSW 17 78313266 missense possibly damaging 0.83
R5461:Crim1 UTSW 17 78237807 missense probably damaging 1.00
R5635:Crim1 UTSW 17 78315641 missense probably damaging 1.00
R5686:Crim1 UTSW 17 78374083 missense possibly damaging 0.63
R5956:Crim1 UTSW 17 78315717 missense probably damaging 1.00
R6117:Crim1 UTSW 17 78303088 missense probably damaging 1.00
R6129:Crim1 UTSW 17 78281309 missense probably benign 0.17
R6265:Crim1 UTSW 17 78370085 missense probably benign 0.01
R6812:Crim1 UTSW 17 78315600 missense probably damaging 1.00
R6858:Crim1 UTSW 17 78315627 missense probably damaging 1.00
R8022:Crim1 UTSW 17 78315555 missense possibly damaging 0.82
R8434:Crim1 UTSW 17 78347257 missense probably benign 0.00
R8782:Crim1 UTSW 17 78200877 missense probably damaging 1.00
R8961:Crim1 UTSW 17 78372688 missense possibly damaging 0.65
R8971:Crim1 UTSW 17 78345980 missense possibly damaging 0.89
R9245:Crim1 UTSW 17 78344442 missense probably damaging 1.00
R9250:Crim1 UTSW 17 78370042 missense probably benign
R9401:Crim1 UTSW 17 78350865 frame shift probably null
R9402:Crim1 UTSW 17 78350865 frame shift probably null
R9644:Crim1 UTSW 17 78280068 missense probably damaging 1.00
R9702:Crim1 UTSW 17 78374087 missense probably damaging 1.00
R9710:Crim1 UTSW 17 78303075 nonsense probably null
X0064:Crim1 UTSW 17 78200833 small deletion probably benign
Z1088:Crim1 UTSW 17 78367835 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTACTAGCACAACCGTTCCC -3'
(R):5'- CTGAGTGATCTTCAGCATGGCC -3'

Sequencing Primer
(F):5'- TACCAGGTAACCAGGTTGTATCACG -3'
(R):5'- TCAGCATGGCCCTAAGTATG -3'
Posted On 2020-09-15