Mutagenetix > Incidental Mutation

Incidental Mutation 'R7920:Sptbn2'

648322

Institutional Source

Beutler Lab

Gene Symbol

Sptbn2

Ensembl Gene

ENSMUSG00000067889

Gene Name

spectrin beta, non-erythrocytic 2

Synonyms

Spnb3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7920 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4711208-4752353 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 4749012 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 2037 (R2037G)

Ref Sequence

ENSEMBL: ENSMUSP00000008991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]

AlphaFold

Q68FG2

Predicted Effect

probably benign
Transcript: ENSMUST00000008991
AA Change: R2037G

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: R2037G

Domain	Start	End	E-Value	Type
CH	59	159	1.86e-28	SMART
CH	178	276	2.86e-20	SMART
SPEC	308	414	4.63e-1	SMART
SPEC	428	528	3.07e-23	SMART
SPEC	534	638	4.47e-25	SMART
SPEC	644	744	1.28e-25	SMART
SPEC	750	849	4.98e-23	SMART
SPEC	855	955	1.63e-18	SMART
SPEC	961	1062	1.45e-24	SMART
SPEC	1068	1169	4.15e-20	SMART
SPEC	1175	1275	5.26e-22	SMART
SPEC	1281	1380	1.17e-19	SMART
SPEC	1386	1485	2.06e-24	SMART
SPEC	1491	1585	1.74e-22	SMART
SPEC	1591	1691	5.42e-24	SMART
SPEC	1697	1798	2.1e-21	SMART
SPEC	1804	1904	5.47e-20	SMART
SPEC	1910	2010	1.99e-22	SMART
SPEC	2016	2256	2.92e-6	SMART
PH	2219	2330	1.65e-14	SMART
low complexity region	2373	2386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178353

SMART Domains

Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

Domain	Start	End	E-Value	Type
RRM	2	69	1.96e-17	SMART
Pfam:RRM_1	81	118	5.6e-7	PFAM

Meta Mutation Damage Score

0.1824

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024B05Rik	T	C	14: 41,996,173	S9P	probably damaging	Het
AI661453	A	T	17: 47,468,406	Q1019L	unknown	Het
Aldh1a1	T	A	19: 20,617,937	W77R	probably damaging	Het
Cc2d2a	T	C	5: 43,739,309	I1516T	probably benign	Het
Ccdc149	T	A	5: 52,405,094	I197F	probably damaging	Het
Ccdc189	A	G	7: 127,587,953	M46T	probably benign	Het
Cfb	A	G	17: 34,860,891	V176A	probably benign	Het
Chordc1	A	G	9: 18,302,101	K83E	probably benign	Het
Cic	G	A	7: 25,271,959	V372M	probably benign	Het
Coq2	T	A	5: 100,663,875		probably benign	Het
Cradd	A	G	10: 95,322,711	L58P	probably damaging	Het
Crim1	A	T	17: 78,303,064	D316V	probably damaging	Het
Cyb5rl	C	A	4: 107,071,008	L114I	possibly damaging	Het
Cyp2c69	T	G	19: 39,877,803		probably null	Het
Ddhd1	A	G	14: 45,657,470	F181S	probably damaging	Het
Dennd1b	G	A	1: 139,062,873	E192K	probably damaging	Het
Dmrt1	T	C	19: 25,506,019	S56P	possibly damaging	Het
Dnah12	A	G	14: 26,856,542	E3086G	possibly damaging	Het
Dnah5	A	T	15: 28,453,222	M4380L	probably benign	Het
Dph7	A	T	2: 24,971,612	M346L	probably benign	Het
Dusp27	T	A	1: 166,099,896	N716Y	possibly damaging	Het
Egf	C	T	3: 129,735,840	R307H	probably benign	Het
Fam50b	G	A	13: 34,747,101	E187K	possibly damaging	Het
Fcna	T	C	2: 25,626,286	K112E	probably benign	Het
Fkbp5	A	T	17: 28,429,239	N125K	possibly damaging	Het
Foxo3	C	T	10: 42,197,769	V251I	possibly damaging	Het
Fryl	T	A	5: 73,101,807		probably null	Het
Fsip2	A	G	2: 82,951,021	E253G	possibly damaging	Het
Gm49333	A	G	16: 20,637,692	E428G	possibly damaging	Het
Gprc6a	T	A	10: 51,614,930	T908S	probably benign	Het
Grin2c	A	T	11: 115,254,144	F560L	probably benign	Het
Hao1	T	A	2: 134,548,252	N56Y	probably damaging	Het
Haus3	T	C	5: 34,167,702	I204M	probably benign	Het
Htr3b	C	A	9: 48,937,156	C263F	probably damaging	Het
Ica1	A	T	6: 8,742,274	C120S	probably benign	Het
Inpp4a	T	A	1: 37,367,805	S210T	probably benign	Het
Inpp5d	T	G	1: 87,705,949	I699S	probably damaging	Het
Kcng1	A	G	2: 168,262,984	V314A	probably benign	Het
Lcn11	G	A	2: 25,779,331	V167M	possibly damaging	Het
Lingo3	C	A	10: 80,834,548	R516L	probably benign	Het
Lrmda	T	C	14: 22,596,478	V151A	probably damaging	Het
Ly6g5b	A	C	17: 35,114,602	I133R	probably damaging	Het
Mcidas	G	A	13: 112,998,987	G315S	probably damaging	Het
Miip	C	T	4: 147,862,918	G236S	probably benign	Het
Mroh7	T	C	4: 106,707,576	T562A	probably benign	Het
Nlrc4	A	G	17: 74,427,119	M933T	probably benign	Het
Olfr539	A	T	7: 140,667,901	S198C	possibly damaging	Het
Pkhd1	A	T	1: 20,275,535	D2756E	probably damaging	Het
Plekhm2	T	C	4: 141,632,121	D445G	probably damaging	Het
Ppp1r12c	C	T	7: 4,483,355	G605D	probably benign	Het
Pygb	T	A	2: 150,787,002	N45K	possibly damaging	Het
Scn4b	A	G	9: 45,146,771	T54A	probably damaging	Het
Scrt1	T	A	15: 76,519,217	H191L	unknown	Het
Sdc3	A	G	4: 130,819,196	M289V	probably benign	Het
Shb	C	T	4: 45,489,054		probably null	Het
Slc1a5	A	G	7: 16,793,870	T364A	probably damaging	Het
Slc25a27	A	G	17: 43,649,673	V218A	probably benign	Het
Slc39a4	C	T	15: 76,614,085	G384D	probably damaging	Het
Tmem67	A	T	4: 12,089,284		probably null	Het
Tonsl	C	T	15: 76,634,587	R544H	probably damaging	Het
Trex1	A	G	9: 109,058,089	V278A	unknown	Het
Ttn	A	T	2: 76,795,157	D15107E	probably damaging	Het
Tubgcp5	A	G	7: 55,816,562	T621A	probably benign	Het
Zfhx4	T	C	3: 5,400,455	V1916A	possibly damaging	Het
Zfp260	A	T	7: 30,105,592	K306*	probably null	Het
Zkscan7	A	T	9: 122,895,909	T648S	probably benign	Het
Zscan4c	T	A	7: 11,009,772	F433I	possibly damaging	Het

Other mutations in Sptbn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sptbn2	APN	19	4724705	missense	possibly damaging	0.94
IGL00688:Sptbn2	APN	19	4725938	missense	probably damaging	1.00
IGL01339:Sptbn2	APN	19	4745972	nonsense	probably null
IGL01373:Sptbn2	APN	19	4745972	nonsense	probably null
IGL01420:Sptbn2	APN	19	4734125	missense	probably benign
IGL01456:Sptbn2	APN	19	4746749	missense	probably damaging	1.00
IGL01953:Sptbn2	APN	19	4749693	missense	probably benign
IGL03026:Sptbn2	APN	19	4724233	critical splice donor site	probably null
IGL03275:Sptbn2	APN	19	4732661	missense	possibly damaging	0.65
IGL03286:Sptbn2	APN	19	4747832	missense	probably damaging	0.97
F5770:Sptbn2	UTSW	19	4750632	missense	probably damaging	1.00
PIT4696001:Sptbn2	UTSW	19	4745577	missense	probably benign	0.00
R0046:Sptbn2	UTSW	19	4745377	intron	probably benign
R0046:Sptbn2	UTSW	19	4745377	intron	probably benign
R0121:Sptbn2	UTSW	19	4745293	missense	probably damaging	1.00
R0127:Sptbn2	UTSW	19	4724744	missense	probably damaging	1.00
R0212:Sptbn2	UTSW	19	4746942	critical splice donor site	probably null
R0277:Sptbn2	UTSW	19	4745145	missense	probably benign	0.28
R0417:Sptbn2	UTSW	19	4737926	missense	probably benign	0.01
R0457:Sptbn2	UTSW	19	4745938	missense	possibly damaging	0.89
R0536:Sptbn2	UTSW	19	4726690	missense	probably damaging	0.99
R0631:Sptbn2	UTSW	19	4739986	missense	probably benign	0.01
R0734:Sptbn2	UTSW	19	4748123	nonsense	probably null
R0742:Sptbn2	UTSW	19	4718983	missense	possibly damaging	0.46
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1364:Sptbn2	UTSW	19	4732665	missense	probably damaging	1.00
R1495:Sptbn2	UTSW	19	4718976	missense	possibly damaging	0.92
R1498:Sptbn2	UTSW	19	4744246	missense	possibly damaging	0.94
R1606:Sptbn2	UTSW	19	4750242	critical splice donor site	probably null
R1678:Sptbn2	UTSW	19	4750497	missense	probably damaging	1.00
R1746:Sptbn2	UTSW	19	4745964	nonsense	probably null
R1820:Sptbn2	UTSW	19	4726596	missense	probably damaging	0.98
R1830:Sptbn2	UTSW	19	4732541	missense	probably benign	0.09
R1863:Sptbn2	UTSW	19	4732685	missense	possibly damaging	0.54
R1967:Sptbn2	UTSW	19	4745299	missense	probably benign	0.00
R2085:Sptbn2	UTSW	19	4738559	missense	probably benign	0.09
R2301:Sptbn2	UTSW	19	4734138	missense	probably benign	0.00
R2310:Sptbn2	UTSW	19	4718935	missense	probably benign	0.19
R2888:Sptbn2	UTSW	19	4748636	missense	possibly damaging	0.52
R3788:Sptbn2	UTSW	19	4745922	missense	probably damaging	1.00
R4429:Sptbn2	UTSW	19	4738355	missense	probably damaging	1.00
R4536:Sptbn2	UTSW	19	4732602	missense	probably damaging	1.00
R4662:Sptbn2	UTSW	19	4739239	missense	probably damaging	1.00
R4672:Sptbn2	UTSW	19	4732496	missense	probably benign	0.25
R4731:Sptbn2	UTSW	19	4742480	missense	probably damaging	0.96
R4747:Sptbn2	UTSW	19	4748154	missense	probably benign	0.27
R4889:Sptbn2	UTSW	19	4729430	missense	possibly damaging	0.69
R4891:Sptbn2	UTSW	19	4738469	missense	probably damaging	1.00
R4965:Sptbn2	UTSW	19	4729309	missense	probably benign	0.13
R4968:Sptbn2	UTSW	19	4729202	splice site	probably null
R4981:Sptbn2	UTSW	19	4751658	missense	probably benign	0.22
R5159:Sptbn2	UTSW	19	4737857	missense	probably benign	0.12
R5202:Sptbn2	UTSW	19	4724184	missense	probably damaging	1.00
R5253:Sptbn2	UTSW	19	4750082	missense	probably benign	0.01
R5294:Sptbn2	UTSW	19	4718908	missense	possibly damaging	0.67
R5465:Sptbn2	UTSW	19	4750105	missense	probably benign	0.00
R5546:Sptbn2	UTSW	19	4725950	missense	probably damaging	1.00
R5593:Sptbn2	UTSW	19	4748947	missense	probably damaging	1.00
R5780:Sptbn2	UTSW	19	4724667	missense	probably damaging	1.00
R5835:Sptbn2	UTSW	19	4738219	missense	probably damaging	1.00
R6008:Sptbn2	UTSW	19	4739278	missense	possibly damaging	0.89
R6108:Sptbn2	UTSW	19	4731392	critical splice donor site	probably null
R6236:Sptbn2	UTSW	19	4748138	missense	probably benign	0.01
R6307:Sptbn2	UTSW	19	4724646	missense	probably damaging	1.00
R6383:Sptbn2	UTSW	19	4732496	missense	possibly damaging	0.89
R6397:Sptbn2	UTSW	19	4742418	missense	possibly damaging	0.91
R6453:Sptbn2	UTSW	19	4744180	missense	possibly damaging	0.67
R6561:Sptbn2	UTSW	19	4747926	missense	probably benign	0.39
R6564:Sptbn2	UTSW	19	4732024	missense	probably damaging	1.00
R6644:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R6703:Sptbn2	UTSW	19	4749814	missense	probably benign
R6703:Sptbn2	UTSW	19	4749815	missense	probably benign
R6753:Sptbn2	UTSW	19	4747785	missense	probably benign	0.01
R7007:Sptbn2	UTSW	19	4744145	missense	possibly damaging	0.82
R7131:Sptbn2	UTSW	19	4749460	missense	probably null
R7219:Sptbn2	UTSW	19	4724173	missense	probably damaging	1.00
R7285:Sptbn2	UTSW	19	4737443	missense	probably benign	0.00
R7308:Sptbn2	UTSW	19	4751574	missense	probably benign
R7469:Sptbn2	UTSW	19	4745118	missense	probably benign	0.00
R7502:Sptbn2	UTSW	19	4748082	missense	probably benign	0.02
R7623:Sptbn2	UTSW	19	4726168	missense	probably damaging	1.00
R7635:Sptbn2	UTSW	19	4744207	missense	probably damaging	1.00
R7733:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7738:Sptbn2	UTSW	19	4724125	missense	probably damaging	1.00
R7742:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7767:Sptbn2	UTSW	19	4734143	missense	possibly damaging	0.62
R7795:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7796:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7871:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7877:Sptbn2	UTSW	19	4744262	missense	possibly damaging	0.93
R7921:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7923:Sptbn2	UTSW	19	4746799	missense	probably benign	0.01
R8137:Sptbn2	UTSW	19	4737403	missense	possibly damaging	0.81
R8305:Sptbn2	UTSW	19	4729130	missense	possibly damaging	0.81
R8695:Sptbn2	UTSW	19	4746696	missense	possibly damaging	0.86
R8790:Sptbn2	UTSW	19	4732024	missense	probably damaging	1.00
R9125:Sptbn2	UTSW	19	4734213	missense	probably benign	0.04
R9483:Sptbn2	UTSW	19	4739946	missense	probably damaging	1.00
R9620:Sptbn2	UTSW	19	4750507	missense	probably damaging	0.99
R9631:Sptbn2	UTSW	19	4738190	missense	probably damaging	1.00
R9646:Sptbn2	UTSW	19	4745313	missense	probably damaging	1.00
R9694:Sptbn2	UTSW	19	4750507	missense	probably damaging	0.99
V7580:Sptbn2	UTSW	19	4750632	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4738205	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4745191	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AACAACGCTGGTCTTTGTCC -3'
(R):5'- AGCACTCTAAGCTCACATGC -3'

Sequencing Primer
(F):5'- CCTGTATTTGAGGTTGATCTGCCC -3'
(R):5'- TCTAAGCTCACATGCAGAGAG -3'

Posted On

2020-09-15