Incidental Mutation 'R0023:Traf3'
ID64833
Institutional Source Beutler Lab
Gene Symbol Traf3
Ensembl Gene ENSMUSG00000021277
Gene NameTNF receptor-associated factor 3
SynonymsLAP1, CRAF1, CD40bp, CAP-1
MMRRC Submission 038318-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0023 (G1)
Quality Score135
Status Validated
Chromosome12
Chromosomal Location111166370-111267153 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 111243478 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 169 (C169*)
Ref Sequence ENSEMBL: ENSMUSP00000112517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021706] [ENSMUST00000060274] [ENSMUST00000117269] [ENSMUST00000139162]
Predicted Effect probably null
Transcript: ENSMUST00000021706
AA Change: C169*
SMART Domains Protein: ENSMUSP00000021706
Gene: ENSMUSG00000021277
AA Change: C169*

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 4.6e-18 PFAM
Pfam:zf-TRAF 191 250 9.9e-14 PFAM
coiled coil region 298 337 N/A INTRINSIC
MATH 419 542 5.69e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000060274
AA Change: C169*
SMART Domains Protein: ENSMUSP00000058361
Gene: ENSMUSG00000021277
AA Change: C169*

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117269
AA Change: C169*
SMART Domains Protein: ENSMUSP00000112517
Gene: ENSMUSG00000021277
AA Change: C169*

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139162
SMART Domains Protein: ENSMUSP00000119010
Gene: ENSMUSG00000021277

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. Several alternatively spliced transcript variants encoding three distinct isoforms have been reported. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in progressive runting, hypoglycemia, and depletion of peripheral white blood cells, leading to death by 10 days of age. Immune responses to T-dependent antigen are impaired in lethally irradiated mice reconstituted with mutant cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Aknad1 T A 3: 108,781,185 C610S probably benign Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bbs1 C T 19: 4,906,014 A44T probably damaging Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Btbd9 A T 17: 30,530,214 V42E probably damaging Het
Carmil3 C G 14: 55,492,876 S15R probably damaging Het
Casp8ap2 A G 4: 32,640,185 D413G probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Clcn3 A T 8: 60,933,070 probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Efcab7 A T 4: 99,901,637 probably benign Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fads1 G A 19: 10,186,897 probably benign Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Gas6 A C 8: 13,470,344 L448R probably damaging Het
Hikeshi T C 7: 89,920,204 probably benign Het
Ifngr1 C T 10: 19,609,449 R399* probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Nr1i3 T C 1: 171,217,331 F247L probably damaging Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Ucp3 G T 7: 100,485,043 V288L probably benign Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r115 G A 17: 23,346,278 E380K probably benign Het
Vmn2r3 T A 3: 64,275,366 N304I probably damaging Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Traf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Traf3 APN 12 111239067 missense probably damaging 0.99
IGL02015:Traf3 APN 12 111252740 missense probably benign
IGL02318:Traf3 APN 12 111237597 missense probably benign
IGL02429:Traf3 APN 12 111243465 missense probably benign 0.19
IGL03088:Traf3 APN 12 111261843 missense probably damaging 0.99
bananasplit UTSW 12 111262036 missense probably damaging 1.00
Han UTSW 12 111261576 missense probably damaging 1.00
Hulk UTSW 12 111261576 missense probably damaging 1.00
sundae UTSW 12 111255224 missense possibly damaging 0.80
R0143:Traf3 UTSW 12 111261576 missense probably damaging 1.00
R1453:Traf3 UTSW 12 111255323 missense probably damaging 0.96
R1507:Traf3 UTSW 12 111260760 missense probably benign 0.30
R1651:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R1714:Traf3 UTSW 12 111242473 missense probably benign 0.01
R1996:Traf3 UTSW 12 111260661 missense probably benign 0.21
R1997:Traf3 UTSW 12 111260661 missense probably benign 0.21
R3946:Traf3 UTSW 12 111255245 missense possibly damaging 0.91
R4477:Traf3 UTSW 12 111248602 missense probably benign 0.00
R4645:Traf3 UTSW 12 111261966 missense probably damaging 1.00
R4723:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R4820:Traf3 UTSW 12 111260770 missense possibly damaging 0.96
R5123:Traf3 UTSW 12 111243518 missense possibly damaging 0.52
R5775:Traf3 UTSW 12 111252728 missense possibly damaging 0.91
R5825:Traf3 UTSW 12 111255361 missense probably benign 0.03
R5912:Traf3 UTSW 12 111255349 missense probably benign 0.01
R6611:Traf3 UTSW 12 111237640 missense possibly damaging 0.76
R6933:Traf3 UTSW 12 111255224 missense possibly damaging 0.80
R7389:Traf3 UTSW 12 111237753 missense probably damaging 1.00
R7425:Traf3 UTSW 12 111260661 nonsense probably null
R8512:Traf3 UTSW 12 111261992 missense probably benign 0.06
X0052:Traf3 UTSW 12 111252736 missense probably benign 0.41
Z1176:Traf3 UTSW 12 111261836 missense probably damaging 1.00
Z1177:Traf3 UTSW 12 111261492 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTTGCCCAGAACTGTCCCAAGAG -3'
(R):5'- TGGTGATCCACCACATGCACAGAG -3'

Sequencing Primer
(F):5'- AGCAAGGTCACAGTGTTCTG -3'
(R):5'- CTGAGGCTATTCTTTGGAACAAG -3'
Posted On2013-08-06