Incidental Mutation 'R7921:Cr2'
ID 648330
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission 045968-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R7921 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 194833975 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 938 (L938Q)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000082321
AA Change: L938Q

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: L938Q

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193356
AA Change: L641Q

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: L641Q

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193436
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195120
AA Change: L938Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: L938Q

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000210219
AA Change: L1314Q

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (84/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,654,954 (GRCm39) M1426R probably benign Het
Adh7 A T 3: 137,929,771 (GRCm39) Y149F probably damaging Het
Ankdd1b C A 13: 96,561,288 (GRCm39) V319F possibly damaging Het
Ankrd13d T C 19: 4,321,058 (GRCm39) D483G probably damaging Het
Anks4b A T 7: 119,781,992 (GRCm39) E341V probably benign Het
Aqp12 A G 1: 92,939,730 (GRCm39) H253R probably benign Het
Atp2c1 A G 9: 105,291,886 (GRCm39) I892T probably damaging Het
Atp8b3 A T 10: 80,366,437 (GRCm39) N275K probably damaging Het
Carmil2 C A 8: 106,417,736 (GRCm39) N610K probably damaging Het
Cd96 GCCCAAAC G 16: 45,858,843 (GRCm39) probably null Het
Cdh10 A T 15: 18,992,042 (GRCm39) I434F probably damaging Het
Celf1 A T 2: 90,829,092 (GRCm39) Q53L probably benign Het
Cers4 T A 8: 4,565,704 (GRCm39) V50E probably damaging Het
Cfap144 T C 11: 58,692,607 (GRCm39) H40R possibly damaging Het
Chd9 T C 8: 91,768,909 (GRCm39) probably null Het
Cir1 A G 2: 73,140,799 (GRCm39) probably null Het
Ckap5 A G 2: 91,379,285 (GRCm39) Y75C probably damaging Het
Cndp1 A G 18: 84,640,383 (GRCm39) M274T probably benign Het
Col22a1 A T 15: 71,853,811 (GRCm39) probably null Het
Col24a1 G T 3: 145,179,993 (GRCm39) G1162C probably damaging Het
Cubn G A 2: 13,429,538 (GRCm39) T1321I probably benign Het
Cyp3a44 G A 5: 145,728,498 (GRCm39) P242L probably damaging Het
Ddx4 A T 13: 112,738,041 (GRCm39) D539E probably benign Het
Dennd1b G A 1: 138,990,611 (GRCm39) E192K probably damaging Het
Dgkd G T 1: 87,851,806 (GRCm39) V403L probably damaging Het
Dnah2 T A 11: 69,411,660 (GRCm39) M321L probably benign Het
Dpy19l1 A T 9: 24,333,634 (GRCm39) M433K possibly damaging Het
Enoph1 A G 5: 100,208,992 (GRCm39) K116E probably benign Het
Exd1 C A 2: 119,360,580 (GRCm39) C174F probably damaging Het
Exoc7 A T 11: 116,188,508 (GRCm39) probably null Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Farp2 G C 1: 93,495,237 (GRCm39) probably null Het
Fbxo22 A T 9: 55,125,637 (GRCm39) I167L probably benign Het
Fchsd2 A G 7: 100,899,749 (GRCm39) N365S probably benign Het
Fgr T G 4: 132,713,832 (GRCm39) probably null Het
Fkbp9 A G 6: 56,828,370 (GRCm39) D194G probably damaging Het
Flnb T C 14: 7,933,800 (GRCm38) S2152P possibly damaging Het
Flnc A G 6: 29,447,769 (GRCm39) I1191V possibly damaging Het
Fpr-rs7 A T 17: 20,333,667 (GRCm39) N274K probably benign Het
Fuca1 A G 4: 135,657,221 (GRCm39) D211G probably damaging Het
Glb1l2 C T 9: 26,685,264 (GRCm39) probably null Het
Gm48552 T C 10: 81,226,826 (GRCm39) *136R probably null Het
Hdgfl2 T C 17: 56,400,724 (GRCm39) probably null Het
Icmt T G 4: 152,387,615 (GRCm39) V270G probably damaging Het
Icosl A T 10: 77,909,574 (GRCm39) D173V probably benign Het
Icosl G A 10: 77,909,786 (GRCm39) V244I probably benign Het
Iqsec1 C T 6: 90,644,923 (GRCm39) R903H probably damaging Het
Lrtm2 G A 6: 119,294,328 (GRCm39) P268S possibly damaging Het
Methig1 T A 15: 100,251,251 (GRCm39) L54Q probably benign Het
Mga T A 2: 119,750,159 (GRCm39) L686H probably damaging Het
Mki67 A T 7: 135,296,933 (GRCm39) S2700R probably benign Het
Muc16 T A 9: 18,570,614 (GRCm39) D635V unknown Het
Muc4 G A 16: 32,570,139 (GRCm39) V400I possibly damaging Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Myh8 T C 11: 67,174,644 (GRCm39) I253T probably damaging Het
Myo15b A T 11: 115,778,004 (GRCm39) K852* probably null Het
Myo19 C T 11: 84,799,064 (GRCm39) T799I possibly damaging Het
Naca T G 10: 127,878,918 (GRCm39) S1317A unknown Het
Nipa1 T C 7: 55,629,558 (GRCm39) Y185C probably damaging Het
Nlrc5 T A 8: 95,214,292 (GRCm39) N910K probably damaging Het
Nucks1 G T 1: 131,838,474 (GRCm39) M1I probably null Het
Nudt13 T C 14: 20,354,140 (GRCm39) V68A probably benign Het
Oacyl A T 18: 65,858,454 (GRCm39) M260L probably benign Het
Or12d16-ps1 C T 17: 37,706,333 (GRCm39) L301F possibly damaging Het
Or51a5 A T 7: 102,771,635 (GRCm39) S115T probably damaging Het
Or6b13 A T 7: 139,782,212 (GRCm39) I157N probably damaging Het
Osbpl6 A G 2: 76,415,441 (GRCm39) N601S probably damaging Het
Pcdh9 A G 14: 93,253,001 (GRCm39) S1221P probably benign Het
Pcdhb16 T C 18: 37,611,298 (GRCm39) L86P probably damaging Het
Pclo A C 5: 14,719,248 (GRCm39) Q1128H unknown Het
Pcnx2 T A 8: 126,564,602 (GRCm39) Y1097F probably benign Het
Per1 T A 11: 68,991,605 (GRCm39) D46E probably damaging Het
Plce1 T A 19: 38,608,997 (GRCm39) D435E probably benign Het
Pramel22 T C 4: 143,383,135 (GRCm39) E28G probably damaging Het
Prkaa1 C A 15: 5,206,632 (GRCm39) Q461K probably damaging Het
Proc C T 18: 32,256,470 (GRCm39) G399D probably damaging Het
Rbak G T 5: 143,160,017 (GRCm39) S345R probably damaging Het
Rsph3b T C 17: 7,172,490 (GRCm39) I325V probably benign Het
Sbf1 A T 15: 89,190,426 (GRCm39) L323Q probably damaging Het
Scd3 G A 19: 44,224,331 (GRCm39) R188H possibly damaging Het
Setdb1 T G 3: 95,233,710 (GRCm39) N1067H possibly damaging Het
Spopl G A 2: 23,435,490 (GRCm39) T15I probably benign Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Stk39 A G 2: 68,137,383 (GRCm39) probably null Het
Syt13 G T 2: 92,783,991 (GRCm39) M420I probably damaging Het
Tas1r1 A T 4: 152,113,118 (GRCm39) I645N possibly damaging Het
Tbx3 G T 5: 119,818,935 (GRCm39) Q523H probably benign Het
Tbx3 A T 5: 119,818,934 (GRCm39) Q523L possibly damaging Het
Tcf23 C T 5: 31,127,494 (GRCm39) Q99* probably null Het
Tfip11 T A 5: 112,483,442 (GRCm39) M619K probably benign Het
Tg A T 15: 66,555,642 (GRCm39) H778L probably benign Het
Utp3 A G 5: 88,702,755 (GRCm39) S95G probably benign Het
Zfp458 T A 13: 67,404,180 (GRCm39) *753L probably null Het
Zfp9 T C 6: 118,442,032 (GRCm39) Y210C possibly damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GTGATGTGCCCCATACTCAAC -3'
(R):5'- TCTGCAATTCAGTGAAGCTTTGC -3'

Sequencing Primer
(F):5'- GTGATGTGCCCCATACTCAACTATAC -3'
(R):5'- GAAGCTTTGCTTACGATAATG -3'
Posted On 2020-09-15