Incidental Mutation 'R7921:Cr2'
ID 648330
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-1, Cr1, CD35, Cr-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock # R7921 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 195136811-195176716 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 195151667 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 938 (L938Q)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000082321
AA Change: L938Q

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: L938Q

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193356
AA Change: L641Q

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: L641Q

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193436
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195120
AA Change: L938Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: L938Q

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000210219
AA Change: L1314Q

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (84/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,677,995 M1426R probably benign Het
Adh7 A T 3: 138,224,010 Y149F probably damaging Het
Ankdd1b C A 13: 96,424,780 V319F possibly damaging Het
Ankrd13d T C 19: 4,271,030 D483G probably damaging Het
Anks4b A T 7: 120,182,769 E341V probably benign Het
Aqp12 A G 1: 93,012,008 H253R probably benign Het
Atp2c1 A G 9: 105,414,687 I892T probably damaging Het
Atp8b3 A T 10: 80,530,603 N275K probably damaging Het
Carmil2 C A 8: 105,691,104 N610K probably damaging Het
Cd96 GCCCAAAC G 16: 46,038,480 probably null Het
Cdh10 A T 15: 18,991,956 I434F probably damaging Het
Celf1 A T 2: 90,998,747 Q53L probably benign Het
Cers4 T A 8: 4,515,704 V50E probably damaging Het
Chd9 T C 8: 91,042,281 probably null Het
Cir1 A G 2: 73,310,455 probably null Het
Ckap5 A G 2: 91,548,940 Y75C probably damaging Het
Cndp1 A G 18: 84,622,258 M274T probably benign Het
Col22a1 A T 15: 71,981,962 probably null Het
Col24a1 G T 3: 145,474,238 G1162C probably damaging Het
Cubn G A 2: 13,424,727 T1321I probably benign Het
Cyp3a44 G A 5: 145,791,688 P242L probably damaging Het
Ddx4 A T 13: 112,601,507 D539E probably benign Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dgkd G T 1: 87,924,084 V403L probably damaging Het
Dnah2 T A 11: 69,520,834 M321L probably benign Het
Dpy19l1 A T 9: 24,422,338 M433K possibly damaging Het
Enoph1 A G 5: 100,061,133 K116E probably benign Het
Exd1 C A 2: 119,530,099 C174F probably damaging Het
Exoc7 A T 11: 116,297,682 probably null Het
Fam183b T C 11: 58,801,781 H40R possibly damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Farp2 G C 1: 93,567,515 probably null Het
Fbxo22 A T 9: 55,218,353 I167L probably benign Het
Fchsd2 A G 7: 101,250,542 N365S probably benign Het
Fgr T G 4: 132,986,521 probably null Het
Fkbp9 A G 6: 56,851,385 D194G probably damaging Het
Flnb T C 14: 7,933,800 S2152P possibly damaging Het
Flnc A G 6: 29,447,770 I1191V possibly damaging Het
Fpr-rs7 A T 17: 20,113,405 N274K probably benign Het
Fuca1 A G 4: 135,929,910 D211G probably damaging Het
Glb1l2 C T 9: 26,773,968 probably null Het
Gm13088 T C 4: 143,656,565 E28G probably damaging Het
Gm48552 T C 10: 81,390,992 *136R probably null Het
Hdgfl2 T C 17: 56,093,724 probably null Het
Icmt T G 4: 152,303,158 V270G probably damaging Het
Icosl A T 10: 78,073,740 D173V probably benign Het
Icosl G A 10: 78,073,952 V244I probably benign Het
Iqsec1 C T 6: 90,667,941 R903H probably damaging Het
Lrtm2 G A 6: 119,317,367 P268S possibly damaging Het
Methig1 T A 15: 100,353,370 L54Q probably benign Het
Mga T A 2: 119,919,678 L686H probably damaging Het
Mki67 A T 7: 135,695,204 S2700R probably benign Het
Muc16 T A 9: 18,659,318 D635V unknown Het
Muc4 G A 16: 32,751,321 V400I possibly damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Myh8 T C 11: 67,283,818 I253T probably damaging Het
Myo15b A T 11: 115,887,178 K852* probably null Het
Myo19 C T 11: 84,908,238 T799I possibly damaging Het
Naca T G 10: 128,043,049 S1317A unknown Het
Nipa1 T C 7: 55,979,810 Y185C probably damaging Het
Nlrc5 T A 8: 94,487,664 N910K probably damaging Het
Nucks1 G T 1: 131,910,736 M1I probably null Het
Nudt13 T C 14: 20,304,072 V68A probably benign Het
Oacyl A T 18: 65,725,383 M260L probably benign Het
Olfr106-ps C T 17: 37,395,442 L301F possibly damaging Het
Olfr524 A T 7: 140,202,299 I157N probably damaging Het
Olfr586 A T 7: 103,122,428 S115T probably damaging Het
Osbpl6 A G 2: 76,585,097 N601S probably damaging Het
Pcdh9 A G 14: 93,015,565 S1221P probably benign Het
Pcdhb16 T C 18: 37,478,245 L86P probably damaging Het
Pclo A C 5: 14,669,234 Q1128H unknown Het
Pcnx2 T A 8: 125,837,863 Y1097F probably benign Het
Per1 T A 11: 69,100,779 D46E probably damaging Het
Plce1 T A 19: 38,620,553 D435E probably benign Het
Prkaa1 C A 15: 5,177,151 Q461K probably damaging Het
Proc C T 18: 32,123,417 G399D probably damaging Het
Rbak G T 5: 143,174,262 S345R probably damaging Het
Rsph3b T C 17: 6,905,091 I325V probably benign Het
Sbf1 A T 15: 89,306,223 L323Q probably damaging Het
Scd3 G A 19: 44,235,892 R188H possibly damaging Het
Setdb1 T G 3: 95,326,399 N1067H possibly damaging Het
Spopl G A 2: 23,545,478 T15I probably benign Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stk39 A G 2: 68,307,039 probably null Het
Syt13 G T 2: 92,953,646 M420I probably damaging Het
Tas1r1 A T 4: 152,028,661 I645N possibly damaging Het
Tbx3 A T 5: 119,680,869 Q523L possibly damaging Het
Tbx3 G T 5: 119,680,870 Q523H probably benign Het
Tcf23 C T 5: 30,970,150 Q99* probably null Het
Tfip11 T A 5: 112,335,576 M619K probably benign Het
Tg A T 15: 66,683,793 H778L probably benign Het
Utp3 A G 5: 88,554,896 S95G probably benign Het
Zfp458 T A 13: 67,256,116 *753L probably null Het
Zfp9 T C 6: 118,465,071 Y210C possibly damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
Pillar UTSW 1 195155888 nonsense probably null
PIT4354001:Cr2 UTSW 1 195166309 missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 195157452 missense probably benign 0.08
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1422:Cr2 UTSW 1 195171125 missense probably benign 0.01
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1761:Cr2 UTSW 1 195155123 critical splice donor site probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2191:Cr2 UTSW 1 195163381 missense possibly damaging 0.94
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3941:Cr2 UTSW 1 195165814 missense probably damaging 0.97
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R4889:Cr2 UTSW 1 195176585 missense possibly damaging 0.70
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5594:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6866:Cr2 UTSW 1 195151691 missense probably damaging 1.00
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
R7057:Cr2 UTSW 1 195151610 missense possibly damaging 0.83
R7117:Cr2 UTSW 1 195160601 missense possibly damaging 0.79
R7200:Cr2 UTSW 1 195163249 missense probably damaging 1.00
R7209:Cr2 UTSW 1 195168724 missense probably damaging 1.00
R7350:Cr2 UTSW 1 195155286 missense probably benign 0.21
R7414:Cr2 UTSW 1 195150036 missense probably benign
R7453:Cr2 UTSW 1 195165257 splice site probably null
R7479:Cr2 UTSW 1 195158410 critical splice donor site probably null
R7480:Cr2 UTSW 1 195154176 missense probably damaging 1.00
R7570:Cr2 UTSW 1 195169340 nonsense probably null
R7666:Cr2 UTSW 1 195154225 missense probably damaging 1.00
R7923:Cr2 UTSW 1 195168687 missense probably benign 0.03
R8396:Cr2 UTSW 1 195158068 missense probably damaging 1.00
R8503:Cr2 UTSW 1 195163542 missense probably benign
R8517:Cr2 UTSW 1 195155899 missense probably benign 0.03
R8773:Cr2 UTSW 1 195158605 missense probably damaging 1.00
R8849:Cr2 UTSW 1 195157239 missense probably damaging 1.00
R8896:Cr2 UTSW 1 195169273 missense possibly damaging 0.58
R8938:Cr2 UTSW 1 195171116 missense probably damaging 0.99
R9027:Cr2 UTSW 1 195151721 missense probably benign 0.08
R9045:Cr2 UTSW 1 195155372 missense possibly damaging 0.61
R9116:Cr2 UTSW 1 195158669 nonsense probably null
R9137:Cr2 UTSW 1 195168332 critical splice donor site probably null
R9476:Cr2 UTSW 1 195158108 missense probably damaging 0.97
R9497:Cr2 UTSW 1 195168435 missense probably damaging 0.99
R9510:Cr2 UTSW 1 195158108 missense probably damaging 0.97
R9752:Cr2 UTSW 1 195141267 missense probably benign 0.37
R9799:Cr2 UTSW 1 195160680 missense probably benign 0.02
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Z1176:Cr2 UTSW 1 195154153 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GTGATGTGCCCCATACTCAAC -3'
(R):5'- TCTGCAATTCAGTGAAGCTTTGC -3'

Sequencing Primer
(F):5'- GTGATGTGCCCCATACTCAACTATAC -3'
(R):5'- GAAGCTTTGCTTACGATAATG -3'
Posted On 2020-09-15