Mutagenetix > Incidental Mutation

Incidental Mutation 'R7921:Stk39'

648333

Institutional Source

Beutler Lab

Gene Symbol

Stk39

Ensembl Gene

ENSMUSG00000027030

Gene Name

serine/threonine kinase 39

Synonyms

DCHT, Rnl5, RF005, SPAK

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.506) question?

Stock #

R7921 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68210445-68472268 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 68307039 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099776 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102715]

AlphaFold

Q9Z1W9

Predicted Effect

probably null
Transcript: ENSMUST00000102715

SMART Domains

Protein: ENSMUSP00000099776
Gene: ENSMUSG00000027030

Domain	Start	End	E-Value	Type
low complexity region	14	65	N/A	INTRINSIC
S_TKc	75	349	4.44e-80	SMART
Pfam:OSR1_C	463	494	1.3e-15	PFAM

Meta Mutation Damage Score

0.9495

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

95% (84/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase that is thought to function in the cellular stress response pathway. The kinase is activated in response to hypotonic stress, leading to phosphorylation of several cation-chloride-coupled cotransporters. The catalytically active kinase specifically activates the p38 MAP kinase pathway, and its interaction with p38 decreases upon cellular stress, suggesting that this kinase may serve as an intermediate in the response to cellular stress. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced bumetanide-sensitive thallium, a potassium tracer, uptake in dorsal root ganglion neurons and reduced fertility. Mice with an ENU mutation in intron 8 exhibit elevated albumin-creatinine (ACR) ratios. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	G	6: 121,677,995	M1426R	probably benign	Het
Adh7	A	T	3: 138,224,010	Y149F	probably damaging	Het
Ankdd1b	C	A	13: 96,424,780	V319F	possibly damaging	Het
Ankrd13d	T	C	19: 4,271,030	D483G	probably damaging	Het
Anks4b	A	T	7: 120,182,769	E341V	probably benign	Het
Aqp12	A	G	1: 93,012,008	H253R	probably benign	Het
Atp2c1	A	G	9: 105,414,687	I892T	probably damaging	Het
Atp8b3	A	T	10: 80,530,603	N275K	probably damaging	Het
Carmil2	C	A	8: 105,691,104	N610K	probably damaging	Het
Cd96	GCCCAAAC	G	16: 46,038,480		probably null	Het
Cdh10	A	T	15: 18,991,956	I434F	probably damaging	Het
Celf1	A	T	2: 90,998,747	Q53L	probably benign	Het
Cers4	T	A	8: 4,515,704	V50E	probably damaging	Het
Chd9	T	C	8: 91,042,281		probably null	Het
Cir1	A	G	2: 73,310,455		probably null	Het
Ckap5	A	G	2: 91,548,940	Y75C	probably damaging	Het
Cndp1	A	G	18: 84,622,258	M274T	probably benign	Het
Col22a1	A	T	15: 71,981,962		probably null	Het
Col24a1	G	T	3: 145,474,238	G1162C	probably damaging	Het
Cr2	A	T	1: 195,151,667	L938Q	possibly damaging	Het
Cubn	G	A	2: 13,424,727	T1321I	probably benign	Het
Cyp3a44	G	A	5: 145,791,688	P242L	probably damaging	Het
Ddx4	A	T	13: 112,601,507	D539E	probably benign	Het
Dennd1b	G	A	1: 139,062,873	E192K	probably damaging	Het
Dgkd	G	T	1: 87,924,084	V403L	probably damaging	Het
Dnah2	T	A	11: 69,520,834	M321L	probably benign	Het
Dpy19l1	A	T	9: 24,422,338	M433K	possibly damaging	Het
Enoph1	A	G	5: 100,061,133	K116E	probably benign	Het
Exd1	C	A	2: 119,530,099	C174F	probably damaging	Het
Exoc7	A	T	11: 116,297,682		probably null	Het
Fam183b	T	C	11: 58,801,781	H40R	possibly damaging	Het
Fam50b	G	A	13: 34,747,101	E187K	possibly damaging	Het
Farp2	G	C	1: 93,567,515		probably null	Het
Fbxo22	A	T	9: 55,218,353	I167L	probably benign	Het
Fchsd2	A	G	7: 101,250,542	N365S	probably benign	Het
Fgr	T	G	4: 132,986,521		probably null	Het
Fkbp9	A	G	6: 56,851,385	D194G	probably damaging	Het
Flnb	T	C	14: 7,933,800	S2152P	possibly damaging	Het
Flnc	A	G	6: 29,447,770	I1191V	possibly damaging	Het
Fpr-rs7	A	T	17: 20,113,405	N274K	probably benign	Het
Fuca1	A	G	4: 135,929,910	D211G	probably damaging	Het
Glb1l2	C	T	9: 26,773,968		probably null	Het
Gm13088	T	C	4: 143,656,565	E28G	probably damaging	Het
Gm48552	T	C	10: 81,390,992	*136R	probably null	Het
Hdgfl2	T	C	17: 56,093,724		probably null	Het
Icmt	T	G	4: 152,303,158	V270G	probably damaging	Het
Icosl	A	T	10: 78,073,740	D173V	probably benign	Het
Icosl	G	A	10: 78,073,952	V244I	probably benign	Het
Iqsec1	C	T	6: 90,667,941	R903H	probably damaging	Het
Lrtm2	G	A	6: 119,317,367	P268S	possibly damaging	Het
Methig1	T	A	15: 100,353,370	L54Q	probably benign	Het
Mga	T	A	2: 119,919,678	L686H	probably damaging	Het
Mki67	A	T	7: 135,695,204	S2700R	probably benign	Het
Muc16	T	A	9: 18,659,318	D635V	unknown	Het
Muc4	G	A	16: 32,751,321	V400I	possibly damaging	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Myh8	T	C	11: 67,283,818	I253T	probably damaging	Het
Myo15b	A	T	11: 115,887,178	K852*	probably null	Het
Myo19	C	T	11: 84,908,238	T799I	possibly damaging	Het
Naca	T	G	10: 128,043,049	S1317A	unknown	Het
Nipa1	T	C	7: 55,979,810	Y185C	probably damaging	Het
Nlrc5	T	A	8: 94,487,664	N910K	probably damaging	Het
Nucks1	G	T	1: 131,910,736	M1I	probably null	Het
Nudt13	T	C	14: 20,304,072	V68A	probably benign	Het
Oacyl	A	T	18: 65,725,383	M260L	probably benign	Het
Olfr106-ps	C	T	17: 37,395,442	L301F	possibly damaging	Het
Olfr524	A	T	7: 140,202,299	I157N	probably damaging	Het
Olfr586	A	T	7: 103,122,428	S115T	probably damaging	Het
Osbpl6	A	G	2: 76,585,097	N601S	probably damaging	Het
Pcdh9	A	G	14: 93,015,565	S1221P	probably benign	Het
Pcdhb16	T	C	18: 37,478,245	L86P	probably damaging	Het
Pclo	A	C	5: 14,669,234	Q1128H	unknown	Het
Pcnx2	T	A	8: 125,837,863	Y1097F	probably benign	Het
Per1	T	A	11: 69,100,779	D46E	probably damaging	Het
Plce1	T	A	19: 38,620,553	D435E	probably benign	Het
Prkaa1	C	A	15: 5,177,151	Q461K	probably damaging	Het
Proc	C	T	18: 32,123,417	G399D	probably damaging	Het
Rbak	G	T	5: 143,174,262	S345R	probably damaging	Het
Rsph3b	T	C	17: 6,905,091	I325V	probably benign	Het
Sbf1	A	T	15: 89,306,223	L323Q	probably damaging	Het
Scd3	G	A	19: 44,235,892	R188H	possibly damaging	Het
Setdb1	T	G	3: 95,326,399	N1067H	possibly damaging	Het
Spopl	G	A	2: 23,545,478	T15I	probably benign	Het
Sptbn2	C	G	19: 4,749,012	R2037G	probably benign	Het
Syt13	G	T	2: 92,953,646	M420I	probably damaging	Het
Tas1r1	A	T	4: 152,028,661	I645N	possibly damaging	Het
Tbx3	A	T	5: 119,680,869	Q523L	possibly damaging	Het
Tbx3	G	T	5: 119,680,870	Q523H	probably benign	Het
Tcf23	C	T	5: 30,970,150	Q99*	probably null	Het
Tfip11	T	A	5: 112,335,576	M619K	probably benign	Het
Tg	A	T	15: 66,683,793	H778L	probably benign	Het
Utp3	A	G	5: 88,554,896	S95G	probably benign	Het
Zfp458	T	A	13: 67,256,116	*753L	probably null	Het
Zfp9	T	C	6: 118,465,071	Y210C	possibly damaging	Het

Other mutations in Stk39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Stk39	APN	2	68314564	missense	possibly damaging	0.81
IGL00966:Stk39	APN	2	68211958	missense	probably benign	0.01
IGL01936:Stk39	APN	2	68314564	missense	probably benign	0.21
IGL02301:Stk39	APN	2	68211962	missense	probably damaging	1.00
IGL02940:Stk39	APN	2	68220899	splice site	probably null
claimjumper	UTSW	2	68314579	missense	probably damaging	0.96
outlaw	UTSW	2	68307039	critical splice donor site	probably null
rustler	UTSW	2	68263303	missense	probably damaging	1.00
R0570:Stk39	UTSW	2	68410048	missense	probably damaging	1.00
R0609:Stk39	UTSW	2	68366167	missense	probably damaging	1.00
R0670:Stk39	UTSW	2	68366182	missense	possibly damaging	0.93
R0980:Stk39	UTSW	2	68392171	missense	probably damaging	1.00
R1024:Stk39	UTSW	2	68410046	missense	probably damaging	1.00
R1573:Stk39	UTSW	2	68390949	missense	probably damaging	1.00
R1713:Stk39	UTSW	2	68307116	splice site	probably benign
R2223:Stk39	UTSW	2	68314579	missense	probably damaging	0.96
R3700:Stk39	UTSW	2	68392118	missense	probably damaging	1.00
R4207:Stk39	UTSW	2	68220920	missense	probably benign	0.42
R4298:Stk39	UTSW	2	68390940	missense	probably damaging	1.00
R4726:Stk39	UTSW	2	68263303	missense	probably damaging	1.00
R4975:Stk39	UTSW	2	68220992	intron	probably benign
R5057:Stk39	UTSW	2	68220948	missense	probably damaging	0.99
R5384:Stk39	UTSW	2	68410039	missense	probably damaging	1.00
R5921:Stk39	UTSW	2	68366105	missense	probably damaging	0.97
R6125:Stk39	UTSW	2	68392124	missense	probably damaging	1.00
R6251:Stk39	UTSW	2	68307039	critical splice donor site	probably null
R6332:Stk39	UTSW	2	68410043	missense	possibly damaging	0.93
R6375:Stk39	UTSW	2	68392238	missense	probably benign	0.34
R7057:Stk39	UTSW	2	68410127	missense	possibly damaging	0.88
R7064:Stk39	UTSW	2	68358812	critical splice donor site	probably null
R7691:Stk39	UTSW	2	68471639	missense	probably damaging	0.97
R8155:Stk39	UTSW	2	68267066	missense	probably damaging	1.00
R8920:Stk39	UTSW	2	68471847	missense	unknown
R9003:Stk39	UTSW	2	68392118	missense	probably damaging	0.98
R9530:Stk39	UTSW	2	68368411	missense	probably damaging	1.00
R9682:Stk39	UTSW	2	68366105	missense	probably damaging	0.97
R9784:Stk39	UTSW	2	68368431	missense	probably damaging	1.00
Z1176:Stk39	UTSW	2	68392198	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTACAGATGCTTTCAAATGG -3'
(R):5'- GACCTTCTGGGATAAGCACTAATC -3'

Sequencing Primer
(F):5'- CAGATGCTTTCAAATGGTGTTTCTC -3'
(R):5'- TCTTGAAGTTTCCAGAAAGGGC -3'

Posted On

2020-09-15