Mutagenetix > Incidental Mutation

Incidental Mutation 'R7921:Col24a1'

648343

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7921 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 145474238 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 1162 (G1162C)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848]

AlphaFold

Q30D77

Predicted Effect

probably damaging
Transcript: ENSMUST00000029848
AA Change: G1162C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: G1162C

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

95% (84/88)

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	G	6: 121,677,995	M1426R	probably benign	Het
Adh7	A	T	3: 138,224,010	Y149F	probably damaging	Het
Ankdd1b	C	A	13: 96,424,780	V319F	possibly damaging	Het
Ankrd13d	T	C	19: 4,271,030	D483G	probably damaging	Het
Anks4b	A	T	7: 120,182,769	E341V	probably benign	Het
Aqp12	A	G	1: 93,012,008	H253R	probably benign	Het
Atp2c1	A	G	9: 105,414,687	I892T	probably damaging	Het
Atp8b3	A	T	10: 80,530,603	N275K	probably damaging	Het
Carmil2	C	A	8: 105,691,104	N610K	probably damaging	Het
Cd96	GCCCAAAC	G	16: 46,038,480		probably null	Het
Cdh10	A	T	15: 18,991,956	I434F	probably damaging	Het
Celf1	A	T	2: 90,998,747	Q53L	probably benign	Het
Cers4	T	A	8: 4,515,704	V50E	probably damaging	Het
Chd9	T	C	8: 91,042,281		probably null	Het
Cir1	A	G	2: 73,310,455		probably null	Het
Ckap5	A	G	2: 91,548,940	Y75C	probably damaging	Het
Cndp1	A	G	18: 84,622,258	M274T	probably benign	Het
Col22a1	A	T	15: 71,981,962		probably null	Het
Cr2	A	T	1: 195,151,667	L938Q	possibly damaging	Het
Cubn	G	A	2: 13,424,727	T1321I	probably benign	Het
Cyp3a44	G	A	5: 145,791,688	P242L	probably damaging	Het
Ddx4	A	T	13: 112,601,507	D539E	probably benign	Het
Dennd1b	G	A	1: 139,062,873	E192K	probably damaging	Het
Dgkd	G	T	1: 87,924,084	V403L	probably damaging	Het
Dnah2	T	A	11: 69,520,834	M321L	probably benign	Het
Dpy19l1	A	T	9: 24,422,338	M433K	possibly damaging	Het
Enoph1	A	G	5: 100,061,133	K116E	probably benign	Het
Exd1	C	A	2: 119,530,099	C174F	probably damaging	Het
Exoc7	A	T	11: 116,297,682		probably null	Het
Fam183b	T	C	11: 58,801,781	H40R	possibly damaging	Het
Fam50b	G	A	13: 34,747,101	E187K	possibly damaging	Het
Farp2	G	C	1: 93,567,515		probably null	Het
Fbxo22	A	T	9: 55,218,353	I167L	probably benign	Het
Fchsd2	A	G	7: 101,250,542	N365S	probably benign	Het
Fgr	T	G	4: 132,986,521		probably null	Het
Fkbp9	A	G	6: 56,851,385	D194G	probably damaging	Het
Flnb	T	C	14: 7,933,800	S2152P	possibly damaging	Het
Flnc	A	G	6: 29,447,770	I1191V	possibly damaging	Het
Fpr-rs7	A	T	17: 20,113,405	N274K	probably benign	Het
Fuca1	A	G	4: 135,929,910	D211G	probably damaging	Het
Glb1l2	C	T	9: 26,773,968		probably null	Het
Gm13088	T	C	4: 143,656,565	E28G	probably damaging	Het
Gm48552	T	C	10: 81,390,992	*136R	probably null	Het
Hdgfl2	T	C	17: 56,093,724		probably null	Het
Icmt	T	G	4: 152,303,158	V270G	probably damaging	Het
Icosl	A	T	10: 78,073,740	D173V	probably benign	Het
Icosl	G	A	10: 78,073,952	V244I	probably benign	Het
Iqsec1	C	T	6: 90,667,941	R903H	probably damaging	Het
Lrtm2	G	A	6: 119,317,367	P268S	possibly damaging	Het
Methig1	T	A	15: 100,353,370	L54Q	probably benign	Het
Mga	T	A	2: 119,919,678	L686H	probably damaging	Het
Mki67	A	T	7: 135,695,204	S2700R	probably benign	Het
Muc16	T	A	9: 18,659,318	D635V	unknown	Het
Muc4	G	A	16: 32,751,321	V400I	possibly damaging	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Myh8	T	C	11: 67,283,818	I253T	probably damaging	Het
Myo15b	A	T	11: 115,887,178	K852*	probably null	Het
Myo19	C	T	11: 84,908,238	T799I	possibly damaging	Het
Naca	T	G	10: 128,043,049	S1317A	unknown	Het
Nipa1	T	C	7: 55,979,810	Y185C	probably damaging	Het
Nlrc5	T	A	8: 94,487,664	N910K	probably damaging	Het
Nucks1	G	T	1: 131,910,736	M1I	probably null	Het
Nudt13	T	C	14: 20,304,072	V68A	probably benign	Het
Oacyl	A	T	18: 65,725,383	M260L	probably benign	Het
Olfr106-ps	C	T	17: 37,395,442	L301F	possibly damaging	Het
Olfr524	A	T	7: 140,202,299	I157N	probably damaging	Het
Olfr586	A	T	7: 103,122,428	S115T	probably damaging	Het
Osbpl6	A	G	2: 76,585,097	N601S	probably damaging	Het
Pcdh9	A	G	14: 93,015,565	S1221P	probably benign	Het
Pcdhb16	T	C	18: 37,478,245	L86P	probably damaging	Het
Pclo	A	C	5: 14,669,234	Q1128H	unknown	Het
Pcnx2	T	A	8: 125,837,863	Y1097F	probably benign	Het
Per1	T	A	11: 69,100,779	D46E	probably damaging	Het
Plce1	T	A	19: 38,620,553	D435E	probably benign	Het
Prkaa1	C	A	15: 5,177,151	Q461K	probably damaging	Het
Proc	C	T	18: 32,123,417	G399D	probably damaging	Het
Rbak	G	T	5: 143,174,262	S345R	probably damaging	Het
Rsph3b	T	C	17: 6,905,091	I325V	probably benign	Het
Sbf1	A	T	15: 89,306,223	L323Q	probably damaging	Het
Scd3	G	A	19: 44,235,892	R188H	possibly damaging	Het
Setdb1	T	G	3: 95,326,399	N1067H	possibly damaging	Het
Spopl	G	A	2: 23,545,478	T15I	probably benign	Het
Sptbn2	C	G	19: 4,749,012	R2037G	probably benign	Het
Stk39	A	G	2: 68,307,039		probably null	Het
Syt13	G	T	2: 92,953,646	M420I	probably damaging	Het
Tas1r1	A	T	4: 152,028,661	I645N	possibly damaging	Het
Tbx3	A	T	5: 119,680,869	Q523L	possibly damaging	Het
Tbx3	G	T	5: 119,680,870	Q523H	probably benign	Het
Tcf23	C	T	5: 30,970,150	Q99*	probably null	Het
Tfip11	T	A	5: 112,335,576	M619K	probably benign	Het
Tg	A	T	15: 66,683,793	H778L	probably benign	Het
Utp3	A	G	5: 88,554,896	S95G	probably benign	Het
Zfp458	T	A	13: 67,256,116	*753L	probably null	Het
Zfp9	T	C	6: 118,465,071	Y210C	possibly damaging	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTGTAGCGATAAGAGTAATCC -3'
(R):5'- AGCTGTTTAAGACTGTGGAATGC -3'

Sequencing Primer
(F):5'- CAGAGAATTCTGCTTGCCACATG -3'
(R):5'- GGAATGCTTGCAATTCCCG -3'

Posted On

2020-09-15