Incidental Mutation 'R7921:Col24a1'
ID 648343
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
MMRRC Submission 045968-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7921 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144998233-145257766 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 145179993 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 1162 (G1162C)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848]
AlphaFold Q30D77
Predicted Effect probably damaging
Transcript: ENSMUST00000029848
AA Change: G1162C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: G1162C

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (84/88)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,654,954 (GRCm39) M1426R probably benign Het
Adh7 A T 3: 137,929,771 (GRCm39) Y149F probably damaging Het
Ankdd1b C A 13: 96,561,288 (GRCm39) V319F possibly damaging Het
Ankrd13d T C 19: 4,321,058 (GRCm39) D483G probably damaging Het
Anks4b A T 7: 119,781,992 (GRCm39) E341V probably benign Het
Aqp12 A G 1: 92,939,730 (GRCm39) H253R probably benign Het
Atp2c1 A G 9: 105,291,886 (GRCm39) I892T probably damaging Het
Atp8b3 A T 10: 80,366,437 (GRCm39) N275K probably damaging Het
Carmil2 C A 8: 106,417,736 (GRCm39) N610K probably damaging Het
Cd96 GCCCAAAC G 16: 45,858,843 (GRCm39) probably null Het
Cdh10 A T 15: 18,992,042 (GRCm39) I434F probably damaging Het
Celf1 A T 2: 90,829,092 (GRCm39) Q53L probably benign Het
Cers4 T A 8: 4,565,704 (GRCm39) V50E probably damaging Het
Cfap144 T C 11: 58,692,607 (GRCm39) H40R possibly damaging Het
Chd9 T C 8: 91,768,909 (GRCm39) probably null Het
Cir1 A G 2: 73,140,799 (GRCm39) probably null Het
Ckap5 A G 2: 91,379,285 (GRCm39) Y75C probably damaging Het
Cndp1 A G 18: 84,640,383 (GRCm39) M274T probably benign Het
Col22a1 A T 15: 71,853,811 (GRCm39) probably null Het
Cr2 A T 1: 194,833,975 (GRCm39) L938Q possibly damaging Het
Cubn G A 2: 13,429,538 (GRCm39) T1321I probably benign Het
Cyp3a44 G A 5: 145,728,498 (GRCm39) P242L probably damaging Het
Ddx4 A T 13: 112,738,041 (GRCm39) D539E probably benign Het
Dennd1b G A 1: 138,990,611 (GRCm39) E192K probably damaging Het
Dgkd G T 1: 87,851,806 (GRCm39) V403L probably damaging Het
Dnah2 T A 11: 69,411,660 (GRCm39) M321L probably benign Het
Dpy19l1 A T 9: 24,333,634 (GRCm39) M433K possibly damaging Het
Enoph1 A G 5: 100,208,992 (GRCm39) K116E probably benign Het
Exd1 C A 2: 119,360,580 (GRCm39) C174F probably damaging Het
Exoc7 A T 11: 116,188,508 (GRCm39) probably null Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Farp2 G C 1: 93,495,237 (GRCm39) probably null Het
Fbxo22 A T 9: 55,125,637 (GRCm39) I167L probably benign Het
Fchsd2 A G 7: 100,899,749 (GRCm39) N365S probably benign Het
Fgr T G 4: 132,713,832 (GRCm39) probably null Het
Fkbp9 A G 6: 56,828,370 (GRCm39) D194G probably damaging Het
Flnb T C 14: 7,933,800 (GRCm38) S2152P possibly damaging Het
Flnc A G 6: 29,447,769 (GRCm39) I1191V possibly damaging Het
Fpr-rs7 A T 17: 20,333,667 (GRCm39) N274K probably benign Het
Fuca1 A G 4: 135,657,221 (GRCm39) D211G probably damaging Het
Glb1l2 C T 9: 26,685,264 (GRCm39) probably null Het
Gm48552 T C 10: 81,226,826 (GRCm39) *136R probably null Het
Hdgfl2 T C 17: 56,400,724 (GRCm39) probably null Het
Icmt T G 4: 152,387,615 (GRCm39) V270G probably damaging Het
Icosl A T 10: 77,909,574 (GRCm39) D173V probably benign Het
Icosl G A 10: 77,909,786 (GRCm39) V244I probably benign Het
Iqsec1 C T 6: 90,644,923 (GRCm39) R903H probably damaging Het
Lrtm2 G A 6: 119,294,328 (GRCm39) P268S possibly damaging Het
Methig1 T A 15: 100,251,251 (GRCm39) L54Q probably benign Het
Mga T A 2: 119,750,159 (GRCm39) L686H probably damaging Het
Mki67 A T 7: 135,296,933 (GRCm39) S2700R probably benign Het
Muc16 T A 9: 18,570,614 (GRCm39) D635V unknown Het
Muc4 G A 16: 32,570,139 (GRCm39) V400I possibly damaging Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Myh8 T C 11: 67,174,644 (GRCm39) I253T probably damaging Het
Myo15b A T 11: 115,778,004 (GRCm39) K852* probably null Het
Myo19 C T 11: 84,799,064 (GRCm39) T799I possibly damaging Het
Naca T G 10: 127,878,918 (GRCm39) S1317A unknown Het
Nipa1 T C 7: 55,629,558 (GRCm39) Y185C probably damaging Het
Nlrc5 T A 8: 95,214,292 (GRCm39) N910K probably damaging Het
Nucks1 G T 1: 131,838,474 (GRCm39) M1I probably null Het
Nudt13 T C 14: 20,354,140 (GRCm39) V68A probably benign Het
Oacyl A T 18: 65,858,454 (GRCm39) M260L probably benign Het
Or12d16-ps1 C T 17: 37,706,333 (GRCm39) L301F possibly damaging Het
Or51a5 A T 7: 102,771,635 (GRCm39) S115T probably damaging Het
Or6b13 A T 7: 139,782,212 (GRCm39) I157N probably damaging Het
Osbpl6 A G 2: 76,415,441 (GRCm39) N601S probably damaging Het
Pcdh9 A G 14: 93,253,001 (GRCm39) S1221P probably benign Het
Pcdhb16 T C 18: 37,611,298 (GRCm39) L86P probably damaging Het
Pclo A C 5: 14,719,248 (GRCm39) Q1128H unknown Het
Pcnx2 T A 8: 126,564,602 (GRCm39) Y1097F probably benign Het
Per1 T A 11: 68,991,605 (GRCm39) D46E probably damaging Het
Plce1 T A 19: 38,608,997 (GRCm39) D435E probably benign Het
Pramel22 T C 4: 143,383,135 (GRCm39) E28G probably damaging Het
Prkaa1 C A 15: 5,206,632 (GRCm39) Q461K probably damaging Het
Proc C T 18: 32,256,470 (GRCm39) G399D probably damaging Het
Rbak G T 5: 143,160,017 (GRCm39) S345R probably damaging Het
Rsph3b T C 17: 7,172,490 (GRCm39) I325V probably benign Het
Sbf1 A T 15: 89,190,426 (GRCm39) L323Q probably damaging Het
Scd3 G A 19: 44,224,331 (GRCm39) R188H possibly damaging Het
Setdb1 T G 3: 95,233,710 (GRCm39) N1067H possibly damaging Het
Spopl G A 2: 23,435,490 (GRCm39) T15I probably benign Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Stk39 A G 2: 68,137,383 (GRCm39) probably null Het
Syt13 G T 2: 92,783,991 (GRCm39) M420I probably damaging Het
Tas1r1 A T 4: 152,113,118 (GRCm39) I645N possibly damaging Het
Tbx3 G T 5: 119,818,935 (GRCm39) Q523H probably benign Het
Tbx3 A T 5: 119,818,934 (GRCm39) Q523L possibly damaging Het
Tcf23 C T 5: 31,127,494 (GRCm39) Q99* probably null Het
Tfip11 T A 5: 112,483,442 (GRCm39) M619K probably benign Het
Tg A T 15: 66,555,642 (GRCm39) H778L probably benign Het
Utp3 A G 5: 88,702,755 (GRCm39) S95G probably benign Het
Zfp458 T A 13: 67,404,180 (GRCm39) *753L probably null Het
Zfp9 T C 6: 118,442,032 (GRCm39) Y210C possibly damaging Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145,068,064 (GRCm39) missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145,167,225 (GRCm39) missense probably benign 0.00
IGL01160:Col24a1 APN 3 145,213,468 (GRCm39) missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145,020,637 (GRCm39) missense probably benign 0.07
IGL01409:Col24a1 APN 3 145,244,319 (GRCm39) missense probably benign 0.19
IGL01587:Col24a1 APN 3 145,139,110 (GRCm39) splice site probably null
IGL01666:Col24a1 APN 3 145,050,447 (GRCm39) missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145,230,018 (GRCm39) splice site probably benign
IGL01721:Col24a1 APN 3 145,244,322 (GRCm39) missense probably benign 0.26
IGL01939:Col24a1 APN 3 145,021,005 (GRCm39) missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145,229,922 (GRCm39) splice site probably null
IGL02002:Col24a1 APN 3 145,062,699 (GRCm39) missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145,020,723 (GRCm39) missense probably benign 0.34
IGL02552:Col24a1 APN 3 145,179,962 (GRCm39) missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145,019,934 (GRCm39) missense probably benign
IGL02582:Col24a1 APN 3 145,020,247 (GRCm39) missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145,198,056 (GRCm39) nonsense probably null
IGL02942:Col24a1 APN 3 145,247,420 (GRCm39) missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145,244,458 (GRCm39) critical splice donor site probably null
IGL03108:Col24a1 APN 3 145,029,162 (GRCm39) missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145,019,744 (GRCm39) splice site probably benign
IGL03405:Col24a1 APN 3 145,020,918 (GRCm39) missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145,229,897 (GRCm39) missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145,251,071 (GRCm39) splice site probably benign
R0556:Col24a1 UTSW 3 145,020,489 (GRCm39) missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 144,998,906 (GRCm39) missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145,019,881 (GRCm39) missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145,034,520 (GRCm39) missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145,166,593 (GRCm39) missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145,095,355 (GRCm39) critical splice donor site probably null
R1713:Col24a1 UTSW 3 145,072,624 (GRCm39) nonsense probably null
R1854:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145,243,022 (GRCm39) critical splice donor site probably null
R1969:Col24a1 UTSW 3 145,020,691 (GRCm39) missense probably benign 0.03
R2216:Col24a1 UTSW 3 145,020,742 (GRCm39) missense probably benign 0.34
R2290:Col24a1 UTSW 3 145,218,950 (GRCm39) missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145,043,621 (GRCm39) missense probably benign 0.01
R3772:Col24a1 UTSW 3 145,251,041 (GRCm39) missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145,167,192 (GRCm39) missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145,230,037 (GRCm39) nonsense probably null
R4433:Col24a1 UTSW 3 145,020,144 (GRCm39) missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145,020,144 (GRCm39) missense probably benign 0.00
R4972:Col24a1 UTSW 3 145,215,439 (GRCm39) missense probably benign 0.42
R5157:Col24a1 UTSW 3 145,051,712 (GRCm39) nonsense probably null
R5216:Col24a1 UTSW 3 145,021,071 (GRCm39) missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145,190,433 (GRCm39) missense probably benign 0.03
R5334:Col24a1 UTSW 3 145,167,280 (GRCm39) missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145,020,786 (GRCm39) nonsense probably null
R5473:Col24a1 UTSW 3 145,243,016 (GRCm39) missense probably benign 0.41
R5538:Col24a1 UTSW 3 144,998,882 (GRCm39) missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145,004,588 (GRCm39) missense probably benign 0.26
R5648:Col24a1 UTSW 3 145,064,321 (GRCm39) missense probably benign 0.00
R5920:Col24a1 UTSW 3 145,133,985 (GRCm39) missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145,020,141 (GRCm39) missense probably benign 0.00
R6728:Col24a1 UTSW 3 145,020,957 (GRCm39) missense probably benign
R6734:Col24a1 UTSW 3 145,214,429 (GRCm39) missense probably benign 0.06
R6861:Col24a1 UTSW 3 145,166,589 (GRCm39) missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145,020,807 (GRCm39) nonsense probably null
R7001:Col24a1 UTSW 3 145,004,627 (GRCm39) missense probably benign 0.28
R7148:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145,192,059 (GRCm39) nonsense probably null
R7315:Col24a1 UTSW 3 145,137,625 (GRCm39) missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 144,998,926 (GRCm39) critical splice donor site probably null
R7371:Col24a1 UTSW 3 145,049,459 (GRCm39) missense probably benign 0.06
R7383:Col24a1 UTSW 3 145,004,599 (GRCm39) missense probably benign
R7605:Col24a1 UTSW 3 145,244,442 (GRCm39) missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145,020,214 (GRCm39) missense probably benign 0.00
R7679:Col24a1 UTSW 3 145,105,110 (GRCm39) missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145,072,656 (GRCm39) splice site probably null
R7701:Col24a1 UTSW 3 145,020,772 (GRCm39) missense probably benign
R7805:Col24a1 UTSW 3 145,019,901 (GRCm39) missense probably benign 0.02
R7913:Col24a1 UTSW 3 145,137,621 (GRCm39) nonsense probably null
R8056:Col24a1 UTSW 3 145,019,925 (GRCm39) missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145,213,457 (GRCm39) missense probably benign 0.31
R8294:Col24a1 UTSW 3 145,186,844 (GRCm39) missense probably null 1.00
R8305:Col24a1 UTSW 3 145,179,937 (GRCm39) missense probably benign 0.00
R8430:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145,251,020 (GRCm39) missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145,019,798 (GRCm39) missense probably null
R9056:Col24a1 UTSW 3 145,021,009 (GRCm39) missense probably damaging 0.96
R9461:Col24a1 UTSW 3 145,186,879 (GRCm39) nonsense probably null
R9612:Col24a1 UTSW 3 145,250,960 (GRCm39) missense probably benign 0.32
R9777:Col24a1 UTSW 3 145,021,103 (GRCm39) nonsense probably null
Z1176:Col24a1 UTSW 3 145,048,259 (GRCm39) missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145,048,260 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGTAGCGATAAGAGTAATCC -3'
(R):5'- AGCTGTTTAAGACTGTGGAATGC -3'

Sequencing Primer
(F):5'- CAGAGAATTCTGCTTGCCACATG -3'
(R):5'- GGAATGCTTGCAATTCCCG -3'
Posted On 2020-09-15