Incidental Mutation 'R0023:Bbs1'
ID64835
Institutional Source Beutler Lab
Gene Symbol Bbs1
Ensembl Gene ENSMUSG00000006464
Gene NameBardet-Biedl syndrome 1 (human)
SynonymsD19Ertd609e
MMRRC Submission 038318-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.769) question?
Stock #R0023 (G1)
Quality Score171
Status Validated
Chromosome19
Chromosomal Location4886898-4906627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4906014 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 44 (A44T)
Ref Sequence ENSEMBL: ENSMUSP00000055321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025851] [ENSMUST00000053506]
Predicted Effect probably benign
Transcript: ENSMUST00000025851
SMART Domains Protein: ENSMUSP00000025851
Gene: ENSMUSG00000063904

DomainStartEndE-ValueType
Pfam:Peptidase_M49 143 704 1.3e-236 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053506
AA Change: A44T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055321
Gene: ENSMUSG00000006464
AA Change: A44T

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:BBS1 23 276 2.7e-104 PFAM
low complexity region 293 305 N/A INTRINSIC
low complexity region 458 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158036
Meta Mutation Damage Score 0.3478 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene have been observed in patients with the major form (type 1) of Bardet-Biedl syndrome. The encoded protein may play a role in eye, limb, cardiac and reproductive system development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display partial embryonic lethality, low body weight before weaning, obesity after weaning, retinal degeneration, and abnormal olfactory epithelium and neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Aknad1 T A 3: 108,781,185 C610S probably benign Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Btbd9 A T 17: 30,530,214 V42E probably damaging Het
Carmil3 C G 14: 55,492,876 S15R probably damaging Het
Casp8ap2 A G 4: 32,640,185 D413G probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Clcn3 A T 8: 60,933,070 probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Efcab7 A T 4: 99,901,637 probably benign Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fads1 G A 19: 10,186,897 probably benign Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Gas6 A C 8: 13,470,344 L448R probably damaging Het
Hikeshi T C 7: 89,920,204 probably benign Het
Ifngr1 C T 10: 19,609,449 R399* probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Nr1i3 T C 1: 171,217,331 F247L probably damaging Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Traf3 T A 12: 111,243,478 C169* probably null Het
Ucp3 G T 7: 100,485,043 V288L probably benign Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r115 G A 17: 23,346,278 E380K probably benign Het
Vmn2r3 T A 3: 64,275,366 N304I probably damaging Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Bbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bbs1 APN 19 4893010 missense probably benign
IGL01110:Bbs1 APN 19 4892925 missense possibly damaging 0.93
IGL01116:Bbs1 APN 19 4902839 splice site probably benign
IGL01480:Bbs1 APN 19 4894393 missense probably damaging 1.00
IGL01926:Bbs1 APN 19 4902863 missense probably benign 0.01
IGL02893:Bbs1 APN 19 4897576 nonsense probably null
IGL03136:Bbs1 APN 19 4890991 missense probably benign 0.10
IGL03342:Bbs1 APN 19 4897593 missense probably damaging 1.00
bookface UTSW 19 4897326 missense possibly damaging 0.81
PIT4131001:Bbs1 UTSW 19 4899259 missense possibly damaging 0.83
PIT4378001:Bbs1 UTSW 19 4891675 missense probably benign 0.05
PIT4468001:Bbs1 UTSW 19 4906162 missense probably benign 0.19
R0023:Bbs1 UTSW 19 4906014 missense probably damaging 1.00
R0127:Bbs1 UTSW 19 4895029 missense probably benign 0.05
R1423:Bbs1 UTSW 19 4894263 missense probably benign 0.08
R1760:Bbs1 UTSW 19 4894322 missense probably benign 0.10
R1992:Bbs1 UTSW 19 4891708 missense probably benign
R2145:Bbs1 UTSW 19 4903707 missense possibly damaging 0.71
R4097:Bbs1 UTSW 19 4897317 missense probably damaging 1.00
R5717:Bbs1 UTSW 19 4897326 missense possibly damaging 0.81
R5947:Bbs1 UTSW 19 4892994 missense probably benign 0.27
R6005:Bbs1 UTSW 19 4903795 nonsense probably null
R6175:Bbs1 UTSW 19 4890721 missense probably damaging 1.00
R6597:Bbs1 UTSW 19 4899306 missense probably benign 0.01
R6734:Bbs1 UTSW 19 4903896 missense probably benign 0.10
R6772:Bbs1 UTSW 19 4906590 unclassified probably benign
R6805:Bbs1 UTSW 19 4900615 missense probably damaging 1.00
R6838:Bbs1 UTSW 19 4903852 missense possibly damaging 0.47
R7198:Bbs1 UTSW 19 4895015 missense probably damaging 0.97
R7276:Bbs1 UTSW 19 4897710 splice site probably null
R7685:Bbs1 UTSW 19 4906154 missense probably benign 0.43
R7696:Bbs1 UTSW 19 4890989 critical splice donor site probably null
R7933:Bbs1 UTSW 19 4891650 splice site probably benign
R8446:Bbs1 UTSW 19 4897605 missense probably benign 0.05
Y5404:Bbs1 UTSW 19 4900607 missense possibly damaging 0.49
Y5407:Bbs1 UTSW 19 4900607 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ATCCACAACATCTTGCTGTTTAACCTCT -3'
(R):5'- GGCCAACATCCACACCTTCTCCT -3'

Sequencing Primer
(F):5'- tcaaactccagcacctacac -3'
(R):5'- CTCCTGCCTGTGTGAGTC -3'
Posted On2013-08-06