Incidental Mutation 'R7921:Tfip11'
ID648352
Institutional Source Beutler Lab
Gene Symbol Tfip11
Ensembl Gene ENSMUSG00000029345
Gene Nametuftelin interacting protein 11
SynonymsTip39
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R7921 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location112326358-112338073 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112335576 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 619 (M619K)
Ref Sequence ENSEMBL: ENSMUSP00000031288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031288] [ENSMUST00000031289] [ENSMUST00000146510] [ENSMUST00000198238]
Predicted Effect probably benign
Transcript: ENSMUST00000031288
AA Change: M619K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031288
Gene: ENSMUSG00000029345
AA Change: M619K

DomainStartEndE-ValueType
Pfam:TIP_N 17 114 1.4e-30 PFAM
G_patch 148 194 3.3e-18 SMART
low complexity region 212 218 N/A INTRINSIC
low complexity region 228 242 N/A INTRINSIC
Pfam:GCFC 398 667 3.4e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031289
SMART Domains Protein: ENSMUSP00000031289
Gene: ENSMUSG00000029346

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
Pfam:SRR1 109 164 2.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146510
SMART Domains Protein: ENSMUSP00000119870
Gene: ENSMUSG00000029346

DomainStartEndE-ValueType
low complexity region 12 53 N/A INTRINSIC
Pfam:SRR1 109 162 1.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198238
SMART Domains Protein: ENSMUSP00000142844
Gene: ENSMUSG00000029345

DomainStartEndE-ValueType
G_patch 8 54 1.9e-20 SMART
low complexity region 72 78 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (84/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein component of the spliceosome that promotes the release of the lariat-intron during late-stage splicing through the recruitment of a pre-mRNA splicing factor called DEAH-box helicase 15. The encoded protein contains a G-patch domain, a hallmark of RNA-processing proteins, that binds DEAH-box helicase 15. This protein contains an atypical nuclear localization sequence as well as a nuclear speckle-targeting sequence, enabling it to localize to distinct speckled regions within the cell nucleus. Polymorphisms in this gene are associated with dental caries suggesting a role in amelogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,677,995 M1426R probably benign Het
Adh7 A T 3: 138,224,010 Y149F probably damaging Het
Ankdd1b C A 13: 96,424,780 V319F possibly damaging Het
Ankrd13d T C 19: 4,271,030 D483G probably damaging Het
Anks4b A T 7: 120,182,769 E341V probably benign Het
Aqp12 A G 1: 93,012,008 H253R probably benign Het
Atp2c1 A G 9: 105,414,687 I892T probably damaging Het
Atp8b3 A T 10: 80,530,603 N275K probably damaging Het
Carmil2 C A 8: 105,691,104 N610K probably damaging Het
Cd96 GCCCAAAC G 16: 46,038,480 probably null Het
Cdh10 A T 15: 18,991,956 I434F probably damaging Het
Celf1 A T 2: 90,998,747 Q53L probably benign Het
Cers4 T A 8: 4,515,704 V50E probably damaging Het
Chd9 T C 8: 91,042,281 probably null Het
Cir1 A G 2: 73,310,455 probably null Het
Ckap5 A G 2: 91,548,940 Y75C probably damaging Het
Cndp1 A G 18: 84,622,258 M274T probably benign Het
Col22a1 A T 15: 71,981,962 probably null Het
Col24a1 G T 3: 145,474,238 G1162C probably damaging Het
Cr2 A T 1: 195,151,667 L938Q possibly damaging Het
Cubn G A 2: 13,424,727 T1321I probably benign Het
Cyp3a44 G A 5: 145,791,688 P242L probably damaging Het
Ddx4 A T 13: 112,601,507 D539E probably benign Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dgkd G T 1: 87,924,084 V403L probably damaging Het
Dnah2 T A 11: 69,520,834 M321L probably benign Het
Dpy19l1 A T 9: 24,422,338 M433K possibly damaging Het
Enoph1 A G 5: 100,061,133 K116E probably benign Het
Exd1 C A 2: 119,530,099 C174F probably damaging Het
Exoc7 A T 11: 116,297,682 probably null Het
Fam183b T C 11: 58,801,781 H40R possibly damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Farp2 G C 1: 93,567,515 probably null Het
Fbxo22 A T 9: 55,218,353 I167L probably benign Het
Fchsd2 A G 7: 101,250,542 N365S probably benign Het
Fgr T G 4: 132,986,521 probably null Het
Fkbp9 A G 6: 56,851,385 D194G probably damaging Het
Flnb T C 14: 7,933,800 S2152P possibly damaging Het
Flnc A G 6: 29,447,770 I1191V possibly damaging Het
Fpr-rs7 A T 17: 20,113,405 N274K probably benign Het
Fuca1 A G 4: 135,929,910 D211G probably damaging Het
Glb1l2 C T 9: 26,773,968 probably null Het
Gm13088 T C 4: 143,656,565 E28G probably damaging Het
Gm48552 T C 10: 81,390,992 *136R probably null Het
Hdgfl2 T C 17: 56,093,724 probably null Het
Icmt T G 4: 152,303,158 V270G probably damaging Het
Icosl A T 10: 78,073,740 D173V probably benign Het
Icosl G A 10: 78,073,952 V244I probably benign Het
Iqsec1 C T 6: 90,667,941 R903H probably damaging Het
Lrtm2 G A 6: 119,317,367 P268S possibly damaging Het
Methig1 T A 15: 100,353,370 L54Q probably benign Het
Mga T A 2: 119,919,678 L686H probably damaging Het
Mki67 A T 7: 135,695,204 S2700R probably benign Het
Muc16 T A 9: 18,659,318 D635V unknown Het
Muc4 G A 16: 32,751,321 V400I possibly damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Myh8 T C 11: 67,283,818 I253T probably damaging Het
Myo15b A T 11: 115,887,178 K852* probably null Het
Myo19 C T 11: 84,908,238 T799I possibly damaging Het
Naca T G 10: 128,043,049 S1317A unknown Het
Nipa1 T C 7: 55,979,810 Y185C probably damaging Het
Nlrc5 T A 8: 94,487,664 N910K probably damaging Het
Nucks1 G T 1: 131,910,736 M1I probably null Het
Nudt13 T C 14: 20,304,072 V68A probably benign Het
Oacyl A T 18: 65,725,383 M260L probably benign Het
Olfr106-ps C T 17: 37,395,442 L301F possibly damaging Het
Olfr524 A T 7: 140,202,299 I157N probably damaging Het
Olfr586 A T 7: 103,122,428 S115T probably damaging Het
Osbpl6 A G 2: 76,585,097 N601S probably damaging Het
Pcdh9 A G 14: 93,015,565 S1221P probably benign Het
Pcdhb16 T C 18: 37,478,245 L86P probably damaging Het
Pclo A C 5: 14,669,234 Q1128H unknown Het
Pcnx2 T A 8: 125,837,863 Y1097F probably benign Het
Per1 T A 11: 69,100,779 D46E probably damaging Het
Plce1 T A 19: 38,620,553 D435E probably benign Het
Prkaa1 C A 15: 5,177,151 Q461K probably damaging Het
Proc C T 18: 32,123,417 G399D probably damaging Het
Rbak G T 5: 143,174,262 S345R probably damaging Het
Rsph3b T C 17: 6,905,091 I325V probably benign Het
Sbf1 A T 15: 89,306,223 L323Q probably damaging Het
Scd3 G A 19: 44,235,892 R188H possibly damaging Het
Setdb1 T G 3: 95,326,399 N1067H possibly damaging Het
Spopl G A 2: 23,545,478 T15I probably benign Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stk39 A G 2: 68,307,039 probably null Het
Syt13 G T 2: 92,953,646 M420I probably damaging Het
Tas1r1 A T 4: 152,028,661 I645N possibly damaging Het
Tbx3 A T 5: 119,680,869 Q523L possibly damaging Het
Tbx3 G T 5: 119,680,870 Q523H probably benign Het
Tcf23 C T 5: 30,970,150 Q99* probably null Het
Tg A T 15: 66,683,793 H778L probably benign Het
Utp3 A G 5: 88,554,896 S95G probably benign Het
Zfp458 T A 13: 67,256,116 *753L probably null Het
Zfp9 T C 6: 118,465,071 Y210C possibly damaging Het
Other mutations in Tfip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Tfip11 APN 5 112329503 missense possibly damaging 0.51
IGL02627:Tfip11 APN 5 112329813 missense possibly damaging 0.69
R0023:Tfip11 UTSW 5 112332009 missense possibly damaging 0.47
R0254:Tfip11 UTSW 5 112335655 missense probably benign 0.06
R0465:Tfip11 UTSW 5 112333264 missense probably benign 0.32
R0569:Tfip11 UTSW 5 112328094 missense probably damaging 1.00
R1411:Tfip11 UTSW 5 112333033 missense probably benign 0.00
R1751:Tfip11 UTSW 5 112334432 missense probably damaging 1.00
R1767:Tfip11 UTSW 5 112334432 missense probably damaging 1.00
R1792:Tfip11 UTSW 5 112329397 missense possibly damaging 0.95
R2125:Tfip11 UTSW 5 112335663 missense possibly damaging 0.46
R4781:Tfip11 UTSW 5 112333399 missense probably damaging 0.99
R4975:Tfip11 UTSW 5 112335747 unclassified probably benign
R5348:Tfip11 UTSW 5 112335668 missense probably benign 0.01
R5385:Tfip11 UTSW 5 112331220 critical splice donor site probably null
R5469:Tfip11 UTSW 5 112334325 nonsense probably null
R6540:Tfip11 UTSW 5 112334397 splice site probably null
R6810:Tfip11 UTSW 5 112333597 missense probably benign 0.07
R7199:Tfip11 UTSW 5 112331178 missense probably benign 0.16
R7342:Tfip11 UTSW 5 112327972 start codon destroyed probably null 0.99
R7352:Tfip11 UTSW 5 112333268 missense probably benign
R8070:Tfip11 UTSW 5 112334930 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTCAGAACCAGAAAGCCTC -3'
(R):5'- GCAATTCTGTGACTGGACAGC -3'

Sequencing Primer
(F):5'- ATCAGATCCCACTGCAGATGGTTG -3'
(R):5'- TTCTGTGACTGGACAGCAGAGG -3'
Posted On2020-09-15