Incidental Mutation 'R0002:Icam5'
ID64839
Institutional Source Beutler Lab
Gene Symbol Icam5
Ensembl Gene ENSMUSG00000032174
Gene Nameintercellular adhesion molecule 5, telencephalin
SynonymsTlcn, TLN, Icam3, CD50
MMRRC Submission 038298-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0002 (G1)
Quality Score88
Status Validated
Chromosome9
Chromosomal Location21032073-21039036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21033505 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 121 (D121E)
Ref Sequence ENSEMBL: ENSMUSP00000019616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001040] [ENSMUST00000019616] [ENSMUST00000086399] [ENSMUST00000215077]
Predicted Effect probably benign
Transcript: ENSMUST00000001040
SMART Domains Protein: ENSMUSP00000001040
Gene: ENSMUSG00000001014

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ICAM_N 37 128 2.5e-17 PFAM
Blast:IG_like 133 224 1e-9 BLAST
transmembrane domain 232 254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019616
AA Change: D121E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019616
Gene: ENSMUSG00000032174
AA Change: D121E

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
Pfam:ICAM_N 32 122 1.5e-17 PFAM
Pfam:Ig_3 121 202 5.6e-4 PFAM
low complexity region 284 292 N/A INTRINSIC
IG_like 329 405 1.45e1 SMART
IG 416 488 1.72e-2 SMART
IG 499 569 5.84e-5 SMART
IG_like 580 662 3.57e1 SMART
IG 673 742 3.49e-3 SMART
IGc2 758 819 1.97e-11 SMART
transmembrane domain 833 855 N/A INTRINSIC
low complexity region 884 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086399
SMART Domains Protein: ENSMUSP00000083587
Gene: ENSMUSG00000037405

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
IG_like 33 109 5.91e1 SMART
IG_like 119 208 1.15e2 SMART
IG 319 396 1.49e-2 SMART
IG 407 479 3.91e-6 SMART
transmembrane domain 486 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180870
Predicted Effect probably benign
Transcript: ENSMUST00000215077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216917
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein is expressed on the surface of telencephalic neurons and displays two types of adhesion activity, homophilic binding between neurons and heterophilic binding between neurons and leukocytes. It may be a critical component in neuron-microglial cell interactions in the course of normal development or as part of neurodegenerative diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit enhanced long-term potentiation, sensorimotor gating, and reward-based learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik A T 9: 36,637,359 D59E probably damaging Het
Bcl2 T C 1: 106,712,511 R124G possibly damaging Het
Catsper1 A G 19: 5,341,523 probably benign Het
Ccdc125 C T 13: 100,693,606 Q295* probably null Het
Cdhr5 G T 7: 141,270,020 probably null Het
Dhx36 A C 3: 62,480,839 L625W probably damaging Het
Ncoa1 A G 12: 4,290,885 V849A probably benign Het
Nuak1 A T 10: 84,375,367 W286R probably damaging Het
Prkag3 T C 1: 74,744,788 D312G probably damaging Het
Sbk3 T C 7: 4,970,631 D17G probably damaging Het
Slc26a5 T A 5: 21,814,983 I530F probably damaging Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Sult3a2 T C 10: 33,779,807 I59V possibly damaging Het
Tapbp C T 17: 33,925,632 A234V probably damaging Het
Tnr T C 1: 159,874,200 Y624H probably damaging Het
Zfp560 T C 9: 20,347,517 Y683C probably damaging Het
Other mutations in Icam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Icam5 APN 9 21036795 critical splice donor site probably null
IGL00972:Icam5 APN 9 21034697 missense probably damaging 0.99
IGL01690:Icam5 APN 9 21034799 missense possibly damaging 0.69
IGL02334:Icam5 APN 9 21035209 missense possibly damaging 0.92
IGL03387:Icam5 APN 9 21033801 missense probably benign 0.10
H8562:Icam5 UTSW 9 21035146 missense probably benign 0.04
R0594:Icam5 UTSW 9 21035598 missense probably benign 0.11
R0605:Icam5 UTSW 9 21032197 missense probably benign 0.23
R1485:Icam5 UTSW 9 21036406 missense probably benign 0.34
R1773:Icam5 UTSW 9 21033525 missense possibly damaging 0.67
R1934:Icam5 UTSW 9 21034786 missense probably benign 0.32
R3125:Icam5 UTSW 9 21036658 missense probably benign 0.00
R4117:Icam5 UTSW 9 21037590 missense probably damaging 0.99
R4132:Icam5 UTSW 9 21036657 missense probably benign
R4250:Icam5 UTSW 9 21037739 missense probably damaging 0.98
R4470:Icam5 UTSW 9 21035506 nonsense probably null
R4471:Icam5 UTSW 9 21035506 nonsense probably null
R4826:Icam5 UTSW 9 21037803 missense possibly damaging 0.67
R5182:Icam5 UTSW 9 21034810 missense probably benign
R5586:Icam5 UTSW 9 21034820 missense probably damaging 0.98
R6200:Icam5 UTSW 9 21038749 missense probably damaging 1.00
R6240:Icam5 UTSW 9 21033158 missense possibly damaging 0.80
R6291:Icam5 UTSW 9 21036921 missense probably benign 0.07
R7229:Icam5 UTSW 9 21037001 missense possibly damaging 0.79
R7395:Icam5 UTSW 9 21035442 missense possibly damaging 0.77
R7414:Icam5 UTSW 9 21037593 missense probably damaging 0.98
R7423:Icam5 UTSW 9 21036905 missense probably benign
R8032:Icam5 UTSW 9 21033218 missense probably benign 0.35
Z1177:Icam5 UTSW 9 21035548 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCGAACTTTCCGTGAGTACAGTGTG -3'
(R):5'- CTCGGCGAGGCATGAGAAATTGAC -3'

Sequencing Primer
(F):5'- AGTACAGTGTGGACACGCC -3'
(R):5'- AGAAATTGACCCTGTGGTCC -3'
Posted On2013-08-06