Incidental Mutation 'R7921:Flnb'
ID 648394
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7921 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 7817957-7951588 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7933800 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2152 (S2152P)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect possibly damaging
Transcript: ENSMUST00000052678
AA Change: S2152P

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: S2152P

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (84/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,677,995 M1426R probably benign Het
Adh7 A T 3: 138,224,010 Y149F probably damaging Het
Ankdd1b C A 13: 96,424,780 V319F possibly damaging Het
Ankrd13d T C 19: 4,271,030 D483G probably damaging Het
Anks4b A T 7: 120,182,769 E341V probably benign Het
Aqp12 A G 1: 93,012,008 H253R probably benign Het
Atp2c1 A G 9: 105,414,687 I892T probably damaging Het
Atp8b3 A T 10: 80,530,603 N275K probably damaging Het
Carmil2 C A 8: 105,691,104 N610K probably damaging Het
Cd96 GCCCAAAC G 16: 46,038,480 probably null Het
Cdh10 A T 15: 18,991,956 I434F probably damaging Het
Celf1 A T 2: 90,998,747 Q53L probably benign Het
Cers4 T A 8: 4,515,704 V50E probably damaging Het
Chd9 T C 8: 91,042,281 probably null Het
Cir1 A G 2: 73,310,455 probably null Het
Ckap5 A G 2: 91,548,940 Y75C probably damaging Het
Cndp1 A G 18: 84,622,258 M274T probably benign Het
Col22a1 A T 15: 71,981,962 probably null Het
Col24a1 G T 3: 145,474,238 G1162C probably damaging Het
Cr2 A T 1: 195,151,667 L938Q possibly damaging Het
Cubn G A 2: 13,424,727 T1321I probably benign Het
Cyp3a44 G A 5: 145,791,688 P242L probably damaging Het
Ddx4 A T 13: 112,601,507 D539E probably benign Het
Dennd1b G A 1: 139,062,873 E192K probably damaging Het
Dgkd G T 1: 87,924,084 V403L probably damaging Het
Dnah2 T A 11: 69,520,834 M321L probably benign Het
Dpy19l1 A T 9: 24,422,338 M433K possibly damaging Het
Enoph1 A G 5: 100,061,133 K116E probably benign Het
Exd1 C A 2: 119,530,099 C174F probably damaging Het
Exoc7 A T 11: 116,297,682 probably null Het
Fam183b T C 11: 58,801,781 H40R possibly damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Farp2 G C 1: 93,567,515 probably null Het
Fbxo22 A T 9: 55,218,353 I167L probably benign Het
Fchsd2 A G 7: 101,250,542 N365S probably benign Het
Fgr T G 4: 132,986,521 probably null Het
Fkbp9 A G 6: 56,851,385 D194G probably damaging Het
Flnc A G 6: 29,447,770 I1191V possibly damaging Het
Fpr-rs7 A T 17: 20,113,405 N274K probably benign Het
Fuca1 A G 4: 135,929,910 D211G probably damaging Het
Glb1l2 C T 9: 26,773,968 probably null Het
Gm13088 T C 4: 143,656,565 E28G probably damaging Het
Gm48552 T C 10: 81,390,992 *136R probably null Het
Hdgfl2 T C 17: 56,093,724 probably null Het
Icmt T G 4: 152,303,158 V270G probably damaging Het
Icosl A T 10: 78,073,740 D173V probably benign Het
Icosl G A 10: 78,073,952 V244I probably benign Het
Iqsec1 C T 6: 90,667,941 R903H probably damaging Het
Lrtm2 G A 6: 119,317,367 P268S possibly damaging Het
Methig1 T A 15: 100,353,370 L54Q probably benign Het
Mga T A 2: 119,919,678 L686H probably damaging Het
Mki67 A T 7: 135,695,204 S2700R probably benign Het
Muc16 T A 9: 18,659,318 D635V unknown Het
Muc4 G A 16: 32,751,321 V400I possibly damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Myh8 T C 11: 67,283,818 I253T probably damaging Het
Myo15b A T 11: 115,887,178 K852* probably null Het
Myo19 C T 11: 84,908,238 T799I possibly damaging Het
Naca T G 10: 128,043,049 S1317A unknown Het
Nipa1 T C 7: 55,979,810 Y185C probably damaging Het
Nlrc5 T A 8: 94,487,664 N910K probably damaging Het
Nucks1 G T 1: 131,910,736 M1I probably null Het
Nudt13 T C 14: 20,304,072 V68A probably benign Het
Oacyl A T 18: 65,725,383 M260L probably benign Het
Olfr106-ps C T 17: 37,395,442 L301F possibly damaging Het
Olfr524 A T 7: 140,202,299 I157N probably damaging Het
Olfr586 A T 7: 103,122,428 S115T probably damaging Het
Osbpl6 A G 2: 76,585,097 N601S probably damaging Het
Pcdh9 A G 14: 93,015,565 S1221P probably benign Het
Pcdhb16 T C 18: 37,478,245 L86P probably damaging Het
Pclo A C 5: 14,669,234 Q1128H unknown Het
Pcnx2 T A 8: 125,837,863 Y1097F probably benign Het
Per1 T A 11: 69,100,779 D46E probably damaging Het
Plce1 T A 19: 38,620,553 D435E probably benign Het
Prkaa1 C A 15: 5,177,151 Q461K probably damaging Het
Proc C T 18: 32,123,417 G399D probably damaging Het
Rbak G T 5: 143,174,262 S345R probably damaging Het
Rsph3b T C 17: 6,905,091 I325V probably benign Het
Sbf1 A T 15: 89,306,223 L323Q probably damaging Het
Scd3 G A 19: 44,235,892 R188H possibly damaging Het
Setdb1 T G 3: 95,326,399 N1067H possibly damaging Het
Spopl G A 2: 23,545,478 T15I probably benign Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stk39 A G 2: 68,307,039 probably null Het
Syt13 G T 2: 92,953,646 M420I probably damaging Het
Tas1r1 A T 4: 152,028,661 I645N possibly damaging Het
Tbx3 A T 5: 119,680,869 Q523L possibly damaging Het
Tbx3 G T 5: 119,680,870 Q523H probably benign Het
Tcf23 C T 5: 30,970,150 Q99* probably null Het
Tfip11 T A 5: 112,335,576 M619K probably benign Het
Tg A T 15: 66,683,793 H778L probably benign Het
Utp3 A G 5: 88,554,896 S95G probably benign Het
Zfp458 T A 13: 67,256,116 *753L probably null Het
Zfp9 T C 6: 118,465,071 Y210C possibly damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7917390 splice site probably benign
IGL01063:Flnb APN 14 7926518 splice site probably benign
IGL01135:Flnb APN 14 7909736 missense probably benign
IGL01139:Flnb APN 14 7945989 missense probably damaging 1.00
IGL01364:Flnb APN 14 7934562 critical splice acceptor site probably null
IGL01417:Flnb APN 14 7905513 missense probably damaging 0.99
IGL01505:Flnb APN 14 7902003 critical splice donor site probably null
IGL01560:Flnb APN 14 7893829 missense probably benign 0.07
IGL01621:Flnb APN 14 7950470 missense probably damaging 1.00
IGL01656:Flnb APN 14 7902010 splice site probably benign
IGL01889:Flnb APN 14 7935967 missense possibly damaging 0.85
IGL01987:Flnb APN 14 7922748 critical splice donor site probably null
IGL02322:Flnb APN 14 7894676 missense probably damaging 1.00
IGL02496:Flnb APN 14 7930919 splice site probably benign
IGL02752:Flnb APN 14 7917338 missense probably benign
IGL03001:Flnb APN 14 7934680 missense probably damaging 0.99
IGL03076:Flnb APN 14 7901988 missense probably benign 0.01
IGL03085:Flnb APN 14 7882211 missense probably benign
IGL03170:Flnb APN 14 7818261 missense possibly damaging 0.90
IGL03373:Flnb APN 14 7890867 critical splice donor site probably null
Boomerang UTSW 14 7901945 missense probably damaging 1.00
Queensland UTSW 14 7927352 missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7942057 missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7896488 missense probably benign 0.15
Rhodelinda UTSW 14 7887682 splice site probably benign
saul UTSW 14 7889183 missense probably damaging 0.99
Xerxes UTSW 14 7867551 missense probably damaging 1.00
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0084:Flnb UTSW 14 7935979 missense probably benign
R0128:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0130:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0148:Flnb UTSW 14 7939077 missense probably benign 0.01
R0166:Flnb UTSW 14 7896115 missense probably damaging 1.00
R0376:Flnb UTSW 14 7946014 critical splice donor site probably null
R0547:Flnb UTSW 14 7912943 splice site probably null
R0612:Flnb UTSW 14 7887682 splice site probably benign
R0656:Flnb UTSW 14 7927352 missense probably damaging 1.00
R0691:Flnb UTSW 14 7890810 missense probably benign 0.16
R1241:Flnb UTSW 14 7896503 missense probably benign 0.06
R1572:Flnb UTSW 14 7883908 missense probably damaging 0.97
R1682:Flnb UTSW 14 7913121 missense probably benign 0.04
R1807:Flnb UTSW 14 7934645 missense probably benign 0.26
R1848:Flnb UTSW 14 7892113 missense probably damaging 1.00
R1959:Flnb UTSW 14 7884735 nonsense probably null
R2078:Flnb UTSW 14 7927466 missense probably damaging 1.00
R2132:Flnb UTSW 14 7873376 missense probably benign 0.04
R2209:Flnb UTSW 14 7905507 nonsense probably null
R2212:Flnb UTSW 14 7881652 small deletion probably benign
R2213:Flnb UTSW 14 7881652 small deletion probably benign
R2363:Flnb UTSW 14 7945950 missense possibly damaging 0.95
R2415:Flnb UTSW 14 7929932 missense probably benign 0.07
R2983:Flnb UTSW 14 7882250 missense probably damaging 1.00
R3001:Flnb UTSW 14 7907162 missense probably benign 0.22
R3002:Flnb UTSW 14 7907162 missense probably benign 0.22
R3436:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3437:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3778:Flnb UTSW 14 7915353 missense probably benign 0.06
R3783:Flnb UTSW 14 7889236 missense probably benign 0.04
R4162:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4163:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4164:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4356:Flnb UTSW 14 7922700 missense probably benign
R4369:Flnb UTSW 14 7942216 missense probably benign
R4783:Flnb UTSW 14 7905701 missense probably benign 0.12
R4785:Flnb UTSW 14 7905701 missense probably benign 0.12
R4790:Flnb UTSW 14 7905661 missense probably benign 0.34
R4828:Flnb UTSW 14 7919238 missense probably benign 0.13
R4882:Flnb UTSW 14 7929936 missense possibly damaging 0.56
R5002:Flnb UTSW 14 7945882 missense probably damaging 1.00
R5058:Flnb UTSW 14 7924262 nonsense probably null
R5184:Flnb UTSW 14 7901945 missense probably damaging 1.00
R5186:Flnb UTSW 14 7909748 missense probably damaging 1.00
R5395:Flnb UTSW 14 7883881 missense probably benign 0.02
R5421:Flnb UTSW 14 7926494 missense probably damaging 1.00
R5667:Flnb UTSW 14 7890843 missense probably benign 0.00
R5671:Flnb UTSW 14 7890843 missense probably benign 0.00
R5714:Flnb UTSW 14 7929073 missense probably damaging 1.00
R5860:Flnb UTSW 14 7931135 missense probably damaging 1.00
R5892:Flnb UTSW 14 7907183 missense probably damaging 1.00
R5924:Flnb UTSW 14 7890765 missense probably benign 0.00
R6131:Flnb UTSW 14 7894635 missense possibly damaging 0.79
R6244:Flnb UTSW 14 7892092 missense probably damaging 1.00
R6489:Flnb UTSW 14 7867551 missense probably damaging 1.00
R6582:Flnb UTSW 14 7892275 critical splice donor site probably null
R6586:Flnb UTSW 14 7929138 missense possibly damaging 0.93
R6611:Flnb UTSW 14 7915318 missense probably damaging 1.00
R6626:Flnb UTSW 14 7929012 missense probably damaging 1.00
R6700:Flnb UTSW 14 7892189 missense probably damaging 0.99
R6738:Flnb UTSW 14 7904536 missense probably benign 0.01
R6864:Flnb UTSW 14 7905640 missense possibly damaging 0.84
R6916:Flnb UTSW 14 7907171 missense probably damaging 0.99
R7117:Flnb UTSW 14 7894214 missense probably benign 0.02
R7164:Flnb UTSW 14 7915944 splice site probably null
R7328:Flnb UTSW 14 7883788 missense possibly damaging 0.95
R7328:Flnb UTSW 14 7894660 nonsense probably null
R7687:Flnb UTSW 14 7924224 missense probably damaging 1.00
R7716:Flnb UTSW 14 7917274 missense possibly damaging 0.64
R7763:Flnb UTSW 14 7926478 missense probably benign 0.00
R7821:Flnb UTSW 14 7939113 missense probably benign 0.00
R8008:Flnb UTSW 14 7892155 missense probably damaging 1.00
R8075:Flnb UTSW 14 7913048 missense probably benign 0.00
R8084:Flnb UTSW 14 7907243 missense probably benign 0.00
R8259:Flnb UTSW 14 7889183 missense probably damaging 0.99
R8441:Flnb UTSW 14 7896488 missense probably benign 0.15
R8493:Flnb UTSW 14 7869822 missense probably damaging 0.97
R8508:Flnb UTSW 14 7950394 missense probably damaging 0.98
R8531:Flnb UTSW 14 7929939 missense probably damaging 1.00
R8812:Flnb UTSW 14 7887624 missense probably benign 0.06
R8814:Flnb UTSW 14 7927409 missense probably damaging 1.00
R8825:Flnb UTSW 14 7887566 missense probably damaging 1.00
R8868:Flnb UTSW 14 7908671 missense probably benign 0.02
R8955:Flnb UTSW 14 7892874 missense probably damaging 1.00
R8955:Flnb UTSW 14 7904688 nonsense probably null
R8976:Flnb UTSW 14 7901882 critical splice acceptor site probably null
R9055:Flnb UTSW 14 7908553 missense probably benign 0.00
R9148:Flnb UTSW 14 7817996 start gained probably benign
R9179:Flnb UTSW 14 7887541 nonsense probably null
R9180:Flnb UTSW 14 7818219 missense probably damaging 1.00
R9189:Flnb UTSW 14 7892976 missense possibly damaging 0.90
R9286:Flnb UTSW 14 7873414 missense probably damaging 0.98
R9288:Flnb UTSW 14 7904498 missense probably benign 0.43
R9354:Flnb UTSW 14 7818411 missense probably benign 0.13
R9484:Flnb UTSW 14 7929004 missense probably benign 0.06
R9505:Flnb UTSW 14 7904665 missense probably benign
R9525:Flnb UTSW 14 7905481 missense probably damaging 1.00
R9621:Flnb UTSW 14 7926421 missense probably damaging 0.99
R9630:Flnb UTSW 14 7926438 nonsense probably null
R9739:Flnb UTSW 14 7935954 nonsense probably null
R9760:Flnb UTSW 14 7929846 missense probably damaging 0.98
X0066:Flnb UTSW 14 7908636 missense probably damaging 1.00
Z1088:Flnb UTSW 14 7905871 missense probably benign 0.04
Z1176:Flnb UTSW 14 7942066 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AACCTTCTCTGCGTGACCTG -3'
(R):5'- CTCTTTAGAGCAATGGGTACAGTTG -3'

Sequencing Primer
(F):5'- ACCTGTGTGCCCTGCATG -3'
(R):5'- GTGAGTCCAGTTAAAACTTGGCCC -3'
Posted On 2020-09-15