Incidental Mutation 'R7921:Fpr-rs7'
ID 648405
Institutional Source Beutler Lab
Gene Symbol Fpr-rs7
Ensembl Gene ENSMUSG00000071276
Gene Name formyl peptide receptor, related sequence 7
Synonyms
MMRRC Submission 045968-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R7921 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 20333472-20334488 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20333667 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 274 (N274K)
Ref Sequence ENSEMBL: ENSMUSP00000093297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095637]
AlphaFold Q71MR7
Predicted Effect probably benign
Transcript: ENSMUST00000095637
AA Change: N274K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000093297
Gene: ENSMUSG00000071276
AA Change: N274K

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 1.2e-38 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (84/88)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,654,954 (GRCm39) M1426R probably benign Het
Adh7 A T 3: 137,929,771 (GRCm39) Y149F probably damaging Het
Ankdd1b C A 13: 96,561,288 (GRCm39) V319F possibly damaging Het
Ankrd13d T C 19: 4,321,058 (GRCm39) D483G probably damaging Het
Anks4b A T 7: 119,781,992 (GRCm39) E341V probably benign Het
Aqp12 A G 1: 92,939,730 (GRCm39) H253R probably benign Het
Atp2c1 A G 9: 105,291,886 (GRCm39) I892T probably damaging Het
Atp8b3 A T 10: 80,366,437 (GRCm39) N275K probably damaging Het
Carmil2 C A 8: 106,417,736 (GRCm39) N610K probably damaging Het
Cd96 GCCCAAAC G 16: 45,858,843 (GRCm39) probably null Het
Cdh10 A T 15: 18,992,042 (GRCm39) I434F probably damaging Het
Celf1 A T 2: 90,829,092 (GRCm39) Q53L probably benign Het
Cers4 T A 8: 4,565,704 (GRCm39) V50E probably damaging Het
Cfap144 T C 11: 58,692,607 (GRCm39) H40R possibly damaging Het
Chd9 T C 8: 91,768,909 (GRCm39) probably null Het
Cir1 A G 2: 73,140,799 (GRCm39) probably null Het
Ckap5 A G 2: 91,379,285 (GRCm39) Y75C probably damaging Het
Cndp1 A G 18: 84,640,383 (GRCm39) M274T probably benign Het
Col22a1 A T 15: 71,853,811 (GRCm39) probably null Het
Col24a1 G T 3: 145,179,993 (GRCm39) G1162C probably damaging Het
Cr2 A T 1: 194,833,975 (GRCm39) L938Q possibly damaging Het
Cubn G A 2: 13,429,538 (GRCm39) T1321I probably benign Het
Cyp3a44 G A 5: 145,728,498 (GRCm39) P242L probably damaging Het
Ddx4 A T 13: 112,738,041 (GRCm39) D539E probably benign Het
Dennd1b G A 1: 138,990,611 (GRCm39) E192K probably damaging Het
Dgkd G T 1: 87,851,806 (GRCm39) V403L probably damaging Het
Dnah2 T A 11: 69,411,660 (GRCm39) M321L probably benign Het
Dpy19l1 A T 9: 24,333,634 (GRCm39) M433K possibly damaging Het
Enoph1 A G 5: 100,208,992 (GRCm39) K116E probably benign Het
Exd1 C A 2: 119,360,580 (GRCm39) C174F probably damaging Het
Exoc7 A T 11: 116,188,508 (GRCm39) probably null Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Farp2 G C 1: 93,495,237 (GRCm39) probably null Het
Fbxo22 A T 9: 55,125,637 (GRCm39) I167L probably benign Het
Fchsd2 A G 7: 100,899,749 (GRCm39) N365S probably benign Het
Fgr T G 4: 132,713,832 (GRCm39) probably null Het
Fkbp9 A G 6: 56,828,370 (GRCm39) D194G probably damaging Het
Flnb T C 14: 7,933,800 (GRCm38) S2152P possibly damaging Het
Flnc A G 6: 29,447,769 (GRCm39) I1191V possibly damaging Het
Fuca1 A G 4: 135,657,221 (GRCm39) D211G probably damaging Het
Glb1l2 C T 9: 26,685,264 (GRCm39) probably null Het
Gm48552 T C 10: 81,226,826 (GRCm39) *136R probably null Het
Hdgfl2 T C 17: 56,400,724 (GRCm39) probably null Het
Icmt T G 4: 152,387,615 (GRCm39) V270G probably damaging Het
Icosl A T 10: 77,909,574 (GRCm39) D173V probably benign Het
Icosl G A 10: 77,909,786 (GRCm39) V244I probably benign Het
Iqsec1 C T 6: 90,644,923 (GRCm39) R903H probably damaging Het
Lrtm2 G A 6: 119,294,328 (GRCm39) P268S possibly damaging Het
Methig1 T A 15: 100,251,251 (GRCm39) L54Q probably benign Het
Mga T A 2: 119,750,159 (GRCm39) L686H probably damaging Het
Mki67 A T 7: 135,296,933 (GRCm39) S2700R probably benign Het
Muc16 T A 9: 18,570,614 (GRCm39) D635V unknown Het
Muc4 G A 16: 32,570,139 (GRCm39) V400I possibly damaging Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Myh8 T C 11: 67,174,644 (GRCm39) I253T probably damaging Het
Myo15b A T 11: 115,778,004 (GRCm39) K852* probably null Het
Myo19 C T 11: 84,799,064 (GRCm39) T799I possibly damaging Het
Naca T G 10: 127,878,918 (GRCm39) S1317A unknown Het
Nipa1 T C 7: 55,629,558 (GRCm39) Y185C probably damaging Het
Nlrc5 T A 8: 95,214,292 (GRCm39) N910K probably damaging Het
Nucks1 G T 1: 131,838,474 (GRCm39) M1I probably null Het
Nudt13 T C 14: 20,354,140 (GRCm39) V68A probably benign Het
Oacyl A T 18: 65,858,454 (GRCm39) M260L probably benign Het
Or12d16-ps1 C T 17: 37,706,333 (GRCm39) L301F possibly damaging Het
Or51a5 A T 7: 102,771,635 (GRCm39) S115T probably damaging Het
Or6b13 A T 7: 139,782,212 (GRCm39) I157N probably damaging Het
Osbpl6 A G 2: 76,415,441 (GRCm39) N601S probably damaging Het
Pcdh9 A G 14: 93,253,001 (GRCm39) S1221P probably benign Het
Pcdhb16 T C 18: 37,611,298 (GRCm39) L86P probably damaging Het
Pclo A C 5: 14,719,248 (GRCm39) Q1128H unknown Het
Pcnx2 T A 8: 126,564,602 (GRCm39) Y1097F probably benign Het
Per1 T A 11: 68,991,605 (GRCm39) D46E probably damaging Het
Plce1 T A 19: 38,608,997 (GRCm39) D435E probably benign Het
Pramel22 T C 4: 143,383,135 (GRCm39) E28G probably damaging Het
Prkaa1 C A 15: 5,206,632 (GRCm39) Q461K probably damaging Het
Proc C T 18: 32,256,470 (GRCm39) G399D probably damaging Het
Rbak G T 5: 143,160,017 (GRCm39) S345R probably damaging Het
Rsph3b T C 17: 7,172,490 (GRCm39) I325V probably benign Het
Sbf1 A T 15: 89,190,426 (GRCm39) L323Q probably damaging Het
Scd3 G A 19: 44,224,331 (GRCm39) R188H possibly damaging Het
Setdb1 T G 3: 95,233,710 (GRCm39) N1067H possibly damaging Het
Spopl G A 2: 23,435,490 (GRCm39) T15I probably benign Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Stk39 A G 2: 68,137,383 (GRCm39) probably null Het
Syt13 G T 2: 92,783,991 (GRCm39) M420I probably damaging Het
Tas1r1 A T 4: 152,113,118 (GRCm39) I645N possibly damaging Het
Tbx3 G T 5: 119,818,935 (GRCm39) Q523H probably benign Het
Tbx3 A T 5: 119,818,934 (GRCm39) Q523L possibly damaging Het
Tcf23 C T 5: 31,127,494 (GRCm39) Q99* probably null Het
Tfip11 T A 5: 112,483,442 (GRCm39) M619K probably benign Het
Tg A T 15: 66,555,642 (GRCm39) H778L probably benign Het
Utp3 A G 5: 88,702,755 (GRCm39) S95G probably benign Het
Zfp458 T A 13: 67,404,180 (GRCm39) *753L probably null Het
Zfp9 T C 6: 118,442,032 (GRCm39) Y210C possibly damaging Het
Other mutations in Fpr-rs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Fpr-rs7 APN 17 20,333,480 (GRCm39) nonsense probably null
IGL01386:Fpr-rs7 APN 17 20,334,454 (GRCm39) missense probably damaging 0.98
IGL02293:Fpr-rs7 APN 17 20,334,232 (GRCm39) missense probably benign 0.01
IGL03303:Fpr-rs7 APN 17 20,334,001 (GRCm39) missense possibly damaging 0.55
R0731:Fpr-rs7 UTSW 17 20,334,116 (GRCm39) missense probably benign 0.00
R0826:Fpr-rs7 UTSW 17 20,333,888 (GRCm39) missense probably benign 0.01
R1439:Fpr-rs7 UTSW 17 20,333,869 (GRCm39) missense probably benign 0.10
R1590:Fpr-rs7 UTSW 17 20,333,678 (GRCm39) missense probably benign 0.05
R1778:Fpr-rs7 UTSW 17 20,334,277 (GRCm39) missense probably damaging 1.00
R4715:Fpr-rs7 UTSW 17 20,333,690 (GRCm39) missense probably benign 0.00
R4744:Fpr-rs7 UTSW 17 20,334,265 (GRCm39) missense probably benign 0.17
R4921:Fpr-rs7 UTSW 17 20,334,082 (GRCm39) missense possibly damaging 0.70
R5540:Fpr-rs7 UTSW 17 20,334,356 (GRCm39) missense probably damaging 1.00
R5677:Fpr-rs7 UTSW 17 20,334,365 (GRCm39) missense probably benign
R5959:Fpr-rs7 UTSW 17 20,334,011 (GRCm39) missense probably benign 0.01
R6042:Fpr-rs7 UTSW 17 20,333,477 (GRCm39) missense probably benign 0.00
R7984:Fpr-rs7 UTSW 17 20,333,671 (GRCm39) missense probably benign 0.01
R8137:Fpr-rs7 UTSW 17 20,334,055 (GRCm39) missense possibly damaging 0.49
R8172:Fpr-rs7 UTSW 17 20,334,443 (GRCm39) missense probably benign 0.04
R8762:Fpr-rs7 UTSW 17 20,333,789 (GRCm39) missense probably benign 0.07
R9134:Fpr-rs7 UTSW 17 20,334,325 (GRCm39) missense probably damaging 1.00
Z1176:Fpr-rs7 UTSW 17 20,333,655 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTCAGGTCCTATGTCTCAGAG -3'
(R):5'- TGTTGGCTTCAGCATACCAATG -3'

Sequencing Primer
(F):5'- CAGGTCCTATGTCTCAGAGTCTTAAG -3'
(R):5'- GGCTTCAGCATACCAATGATCTTC -3'
Posted On 2020-09-15