Incidental Mutation 'R7922:Cfap100'
ID 648439
Institutional Source Beutler Lab
Gene Symbol Cfap100
Ensembl Gene ENSMUSG00000048794
Gene Name cilia and flagella associated protein 100
Synonyms C030041G11Rik, C230069K22Rik, Ccdc37
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R7922 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 90403479-90428797 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 90403980 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 427 (L427V)
Ref Sequence ENSEMBL: ENSMUSP00000059976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062750] [ENSMUST00000075117] [ENSMUST00000153843] [ENSMUST00000165673]
AlphaFold Q80VN0
Predicted Effect unknown
Transcript: ENSMUST00000062750
AA Change: L427V
SMART Domains Protein: ENSMUSP00000059976
Gene: ENSMUSG00000048794
AA Change: L427V

DomainStartEndE-ValueType
Pfam:DUF4200 1 127 5.4e-26 PFAM
coiled coil region 242 282 N/A INTRINSIC
low complexity region 289 309 N/A INTRINSIC
coiled coil region 374 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075117
SMART Domains Protein: ENSMUSP00000074619
Gene: ENSMUSG00000034430

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
low complexity region 799 811 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153843
Predicted Effect unknown
Transcript: ENSMUST00000165673
AA Change: L581V
SMART Domains Protein: ENSMUSP00000126515
Gene: ENSMUSG00000048794
AA Change: L581V

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
Pfam:DUF4200 154 272 1.2e-35 PFAM
coiled coil region 396 436 N/A INTRINSIC
low complexity region 443 463 N/A INTRINSIC
coiled coil region 528 581 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,164,406 T638M possibly damaging Het
4930546C10Rik A G 18: 68,949,996 probably null Het
Abi3 A T 11: 95,832,793 Y342N unknown Het
Adk G A 14: 21,318,043 V195I probably benign Het
Ago2 C T 15: 73,126,526 V268M possibly damaging Het
Apaf1 T C 10: 90,999,753 I1077V probably benign Het
Arap1 A T 7: 101,404,414 K1317* probably null Het
Auts2 T A 5: 131,440,373 D493V Het
Baz1b A T 5: 135,231,679 Q1110L probably damaging Het
Brsk2 T A 7: 141,993,220 S467T possibly damaging Het
Btbd9 A T 17: 30,274,884 M511K probably benign Het
Cdh23 T A 10: 60,382,706 Y1385F probably benign Het
Cnga1 A G 5: 72,604,882 F430L possibly damaging Het
Dnhd1 A T 7: 105,668,514 D472V probably damaging Het
Dock2 T A 11: 34,707,327 E339V probably benign Het
Eif3a A T 19: 60,775,842 V379E probably damaging Het
Erich4 T A 7: 25,615,743 N36Y probably damaging Het
Fam60a T A 6: 148,926,146 T125S probably benign Het
Frem2 T C 3: 53,653,304 T1261A probably damaging Het
Fzd6 A T 15: 39,031,108 D223V probably damaging Het
Gabra2 A T 5: 71,007,972 Y218* probably null Het
Gcn1l1 G T 5: 115,614,468 M2177I probably benign Het
Ghr G A 15: 3,341,074 T103I possibly damaging Het
Gipc1 T C 8: 83,661,228 V79A probably benign Het
Gm10031 A T 1: 156,524,992 L254F probably damaging Het
Gm13272 T A 4: 88,780,340 V164D probably damaging Het
Gramd4 C A 15: 86,131,958 H503Q probably benign Het
Gstm4 A T 3: 108,044,671 M1K probably null Het
Heatr5b T A 17: 78,760,559 Q1800L probably benign Het
Hectd1 T A 12: 51,790,195 K826* probably null Het
Hoxa9 T C 6: 52,224,309 I251V possibly damaging Het
Il2ra A T 2: 11,674,366 I46F possibly damaging Het
Ints2 T A 11: 86,244,627 R320S probably benign Het
Iscu G A 5: 113,774,349 R60Q unknown Het
Iscu A T 5: 113,774,282 N46I probably damaging Het
Kcnk3 A T 5: 30,588,531 H72L probably damaging Het
Kmt2a T G 9: 44,842,860 S1228R unknown Het
Mbl2 T A 19: 30,239,238 L150Q probably damaging Het
Med13 A T 11: 86,271,005 F2166Y probably damaging Het
Mterf4 A C 1: 93,301,553 L246* probably null Het
Muc16 T C 9: 18,584,825 Q6690R probably benign Het
Myh10 T A 11: 68,808,893 L1722Q possibly damaging Het
Neurod2 T C 11: 98,327,628 M237V probably benign Het
Olfml1 A G 7: 107,571,149 Y81C probably damaging Het
Olfr735 A G 14: 50,346,415 V9A probably benign Het
Pcdhga7 A T 18: 37,716,173 N411I probably benign Het
Pcdhgb8 T C 18: 37,763,949 F691L probably benign Het
Pik3c2a A G 7: 116,391,282 V481A probably damaging Het
Pik3r6 A T 11: 68,533,875 R435S probably benign Het
Pkd1l1 G A 11: 8,849,013 H2250Y Het
Pkd1l1 A G 11: 8,909,857 S1034P Het
Plcd1 C A 9: 119,074,652 R400L possibly damaging Het
Ppp2r1a A G 17: 20,954,617 T58A probably benign Het
Ppp5c T C 7: 17,027,800 E5G possibly damaging Het
Pradc1 A C 6: 85,447,968 F82L probably benign Het
Prkag3 A T 1: 74,741,257 S416R probably benign Het
Rab3gap2 T C 1: 185,249,920 C390R probably benign Het
Rhot1 A G 11: 80,265,803 T655A probably benign Het
Rorc A G 3: 94,391,188 I348V probably damaging Het
Ryr1 A T 7: 29,097,224 V1051E probably benign Het
Sema5b GCAC GC 16: 35,658,256 probably null Het
Serpinb3c G A 1: 107,272,014 T259I probably damaging Het
Sh3gl1 A T 17: 56,019,438 M70K probably damaging Het
Slc7a4 C T 16: 17,573,366 V607I probably benign Het
Spop A T 11: 95,471,328 N62Y probably damaging Het
Spout1 A G 2: 30,176,811 F130S probably benign Het
Tab1 A G 15: 80,158,865 H420R possibly damaging Het
Tecpr2 CA C 12: 110,932,642 probably null Het
Tnxb G C 17: 34,714,603 K2332N probably damaging Het
Togaram1 T C 12: 64,967,738 Y588H probably damaging Het
Trim71 G A 9: 114,513,085 R710C probably damaging Het
Tsen54 C T 11: 115,820,782 Q342* probably null Het
Ube2r2 T A 4: 41,190,812 N235K unknown Het
Utrn C A 10: 12,667,527 K1792N possibly damaging Het
Vmn1r122 A G 7: 21,133,662 I156T possibly damaging Het
Vmn1r94 T C 7: 20,167,711 T223A possibly damaging Het
Vmn2r120 G A 17: 57,524,683 R369W probably damaging Het
Vwa7 G T 17: 35,024,433 A717S possibly damaging Het
Zc3h4 T A 7: 16,425,722 C398S unknown Het
Zc3hc1 T A 6: 30,390,875 E43V possibly damaging Het
Zfp101 A T 17: 33,381,537 V415D possibly damaging Het
Zfp553 A G 7: 127,236,596 H441R probably damaging Het
Other mutations in Cfap100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Cfap100 APN 6 90415805 missense probably benign 0.36
IGL01067:Cfap100 APN 6 90406114 missense probably damaging 1.00
IGL01347:Cfap100 APN 6 90406121 missense possibly damaging 0.65
IGL01803:Cfap100 APN 6 90415735 missense probably benign 0.29
IGL01910:Cfap100 APN 6 90409624 missense probably damaging 0.99
IGL02086:Cfap100 APN 6 90413972 missense probably damaging 1.00
IGL02680:Cfap100 APN 6 90412235 missense probably benign 0.03
IGL03046:Cfap100 APN 6 90412350 splice site probably null
R0391:Cfap100 UTSW 6 90405339 splice site probably benign
R0883:Cfap100 UTSW 6 90415906 splice site probably benign
R1022:Cfap100 UTSW 6 90413004 missense possibly damaging 0.50
R1024:Cfap100 UTSW 6 90413004 missense possibly damaging 0.50
R1086:Cfap100 UTSW 6 90403908 nonsense probably null
R1440:Cfap100 UTSW 6 90412184 missense probably benign 0.06
R1914:Cfap100 UTSW 6 90412347 splice site probably benign
R1915:Cfap100 UTSW 6 90412347 splice site probably benign
R2257:Cfap100 UTSW 6 90413820 missense possibly damaging 0.83
R4370:Cfap100 UTSW 6 90413394 missense probably damaging 1.00
R4739:Cfap100 UTSW 6 90412843 critical splice donor site probably null
R4895:Cfap100 UTSW 6 90406102 missense possibly damaging 0.95
R5160:Cfap100 UTSW 6 90413710 critical splice donor site probably null
R5983:Cfap100 UTSW 6 90419391 intron probably benign
R6164:Cfap100 UTSW 6 90415786 missense probably benign 0.15
R6394:Cfap100 UTSW 6 90417623 missense possibly damaging 0.58
R6658:Cfap100 UTSW 6 90413418 missense probably damaging 0.99
R7094:Cfap100 UTSW 6 90413454 missense
R7254:Cfap100 UTSW 6 90406061 missense unknown
R7983:Cfap100 UTSW 6 90415705 missense
R8169:Cfap100 UTSW 6 90417674 missense
R8490:Cfap100 UTSW 6 90413739 utr 3 prime probably benign
R8835:Cfap100 UTSW 6 90409615 missense
R9080:Cfap100 UTSW 6 90406201 missense unknown
R9124:Cfap100 UTSW 6 90409348 missense
R9185:Cfap100 UTSW 6 90413434 missense
R9663:Cfap100 UTSW 6 90409346 missense
Z1176:Cfap100 UTSW 6 90406150 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGGAGTTAGGAACCCCTCAG -3'
(R):5'- CCCTCAAAAGGTATGCTCCATG -3'

Sequencing Primer
(F):5'- GTTAGGAACCCCTCAGGCTCAC -3'
(R):5'- ATGGAGCCTGCACGGTAC -3'
Posted On 2020-09-15