Incidental Mutation 'R7922:Ppp5c'
ID 648442
Institutional Source Beutler Lab
Gene Symbol Ppp5c
Ensembl Gene ENSMUSG00000003099
Gene Name protein phosphatase 5, catalytic subunit
Synonyms ANP receptor, PP5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7922 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 17004640-17027924 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17027800 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 5 (E5G)
Ref Sequence ENSEMBL: ENSMUSP00000003183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003183] [ENSMUST00000108492]
AlphaFold Q60676
Predicted Effect possibly damaging
Transcript: ENSMUST00000003183
AA Change: E5G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000003183
Gene: ENSMUSG00000003099
AA Change: E5G

DomainStartEndE-ValueType
TPR 28 61 1.92e-6 SMART
TPR 62 95 8.29e0 SMART
TPR 96 129 4.28e-4 SMART
PP2Ac 204 480 2.8e-164 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108492
SMART Domains Protein: ENSMUSP00000104132
Gene: ENSMUSG00000004328

DomainStartEndE-ValueType
HLH 20 75 1.57e-7 SMART
PAS 84 150 9.83e-10 SMART
PAS 227 295 2.72e-3 SMART
PAC 301 344 2.18e-2 SMART
low complexity region 423 439 N/A INTRINSIC
Pfam:HIF-1 475 506 5.7e-18 PFAM
low complexity region 510 522 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122783
Gene: ENSMUSG00000003099
AA Change: E3G

DomainStartEndE-ValueType
TPR 27 60 1.92e-6 SMART
TPR 61 94 8.29e0 SMART
TPR 95 128 4.28e-4 SMART
PP2Ac 203 457 1.83e-145 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine phosphatase which is a member of the protein phosphatase catalytic subunit family. Proteins in this family participate in pathways regulated by reversible phosphorylation at serine and threonine residues; many of these pathways are involved in the regulation of cell growth and differentiation. The product of this gene has been shown to participate in signaling pathways in response to hormones or cellular stress, and elevated levels of this protein may be associated with breast cancer development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a decrease in cell cycle check-point arrest following treatment with ionizing radition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,164,406 T638M possibly damaging Het
4930546C10Rik A G 18: 68,949,996 probably null Het
Abi3 A T 11: 95,832,793 Y342N unknown Het
Adk G A 14: 21,318,043 V195I probably benign Het
Ago2 C T 15: 73,126,526 V268M possibly damaging Het
Apaf1 T C 10: 90,999,753 I1077V probably benign Het
Arap1 A T 7: 101,404,414 K1317* probably null Het
Auts2 T A 5: 131,440,373 D493V Het
Baz1b A T 5: 135,231,679 Q1110L probably damaging Het
Brsk2 T A 7: 141,993,220 S467T possibly damaging Het
Btbd9 A T 17: 30,274,884 M511K probably benign Het
Cdh23 T A 10: 60,382,706 Y1385F probably benign Het
Cfap100 A C 6: 90,403,980 L427V unknown Het
Cnga1 A G 5: 72,604,882 F430L possibly damaging Het
Dnhd1 A T 7: 105,668,514 D472V probably damaging Het
Dock2 T A 11: 34,707,327 E339V probably benign Het
Eif3a A T 19: 60,775,842 V379E probably damaging Het
Erich4 T A 7: 25,615,743 N36Y probably damaging Het
Fam60a T A 6: 148,926,146 T125S probably benign Het
Frem2 T C 3: 53,653,304 T1261A probably damaging Het
Fzd6 A T 15: 39,031,108 D223V probably damaging Het
Gabra2 A T 5: 71,007,972 Y218* probably null Het
Gcn1l1 G T 5: 115,614,468 M2177I probably benign Het
Ghr G A 15: 3,341,074 T103I possibly damaging Het
Gipc1 T C 8: 83,661,228 V79A probably benign Het
Gm10031 A T 1: 156,524,992 L254F probably damaging Het
Gm13272 T A 4: 88,780,340 V164D probably damaging Het
Gramd4 C A 15: 86,131,958 H503Q probably benign Het
Gstm4 A T 3: 108,044,671 M1K probably null Het
Heatr5b T A 17: 78,760,559 Q1800L probably benign Het
Hectd1 T A 12: 51,790,195 K826* probably null Het
Hoxa9 T C 6: 52,224,309 I251V possibly damaging Het
Il2ra A T 2: 11,674,366 I46F possibly damaging Het
Ints2 T A 11: 86,244,627 R320S probably benign Het
Iscu G A 5: 113,774,349 R60Q unknown Het
Iscu A T 5: 113,774,282 N46I probably damaging Het
Kcnk3 A T 5: 30,588,531 H72L probably damaging Het
Kmt2a T G 9: 44,842,860 S1228R unknown Het
Mbl2 T A 19: 30,239,238 L150Q probably damaging Het
Med13 A T 11: 86,271,005 F2166Y probably damaging Het
Mterf4 A C 1: 93,301,553 L246* probably null Het
Muc16 T C 9: 18,584,825 Q6690R probably benign Het
Myh10 T A 11: 68,808,893 L1722Q possibly damaging Het
Neurod2 T C 11: 98,327,628 M237V probably benign Het
Olfml1 A G 7: 107,571,149 Y81C probably damaging Het
Olfr735 A G 14: 50,346,415 V9A probably benign Het
Pcdhga7 A T 18: 37,716,173 N411I probably benign Het
Pcdhgb8 T C 18: 37,763,949 F691L probably benign Het
Pik3c2a A G 7: 116,391,282 V481A probably damaging Het
Pik3r6 A T 11: 68,533,875 R435S probably benign Het
Pkd1l1 G A 11: 8,849,013 H2250Y Het
Pkd1l1 A G 11: 8,909,857 S1034P Het
Plcd1 C A 9: 119,074,652 R400L possibly damaging Het
Ppp2r1a A G 17: 20,954,617 T58A probably benign Het
Pradc1 A C 6: 85,447,968 F82L probably benign Het
Prkag3 A T 1: 74,741,257 S416R probably benign Het
Rab3gap2 T C 1: 185,249,920 C390R probably benign Het
Rhot1 A G 11: 80,265,803 T655A probably benign Het
Rorc A G 3: 94,391,188 I348V probably damaging Het
Ryr1 A T 7: 29,097,224 V1051E probably benign Het
Sema5b GCAC GC 16: 35,658,256 probably null Het
Serpinb3c G A 1: 107,272,014 T259I probably damaging Het
Sh3gl1 A T 17: 56,019,438 M70K probably damaging Het
Slc7a4 C T 16: 17,573,366 V607I probably benign Het
Spop A T 11: 95,471,328 N62Y probably damaging Het
Spout1 A G 2: 30,176,811 F130S probably benign Het
Tab1 A G 15: 80,158,865 H420R possibly damaging Het
Tecpr2 CA C 12: 110,932,642 probably null Het
Tnxb G C 17: 34,714,603 K2332N probably damaging Het
Togaram1 T C 12: 64,967,738 Y588H probably damaging Het
Trim71 G A 9: 114,513,085 R710C probably damaging Het
Tsen54 C T 11: 115,820,782 Q342* probably null Het
Ube2r2 T A 4: 41,190,812 N235K unknown Het
Utrn C A 10: 12,667,527 K1792N possibly damaging Het
Vmn1r122 A G 7: 21,133,662 I156T possibly damaging Het
Vmn1r94 T C 7: 20,167,711 T223A possibly damaging Het
Vmn2r120 G A 17: 57,524,683 R369W probably damaging Het
Vwa7 G T 17: 35,024,433 A717S possibly damaging Het
Zc3h4 T A 7: 16,425,722 C398S unknown Het
Zc3hc1 T A 6: 30,390,875 E43V possibly damaging Het
Zfp101 A T 17: 33,381,537 V415D possibly damaging Het
Zfp553 A G 7: 127,236,596 H441R probably damaging Het
Other mutations in Ppp5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Ppp5c APN 7 17008630 missense possibly damaging 0.87
IGL02794:Ppp5c APN 7 17006960 missense probably benign 0.15
IGL02831:Ppp5c APN 7 17008645 missense probably damaging 1.00
IGL02950:Ppp5c APN 7 17006910 missense probably benign 0.00
Persephone UTSW 7 17022443 missense probably benign 0.01
pontius UTSW 7 17007212 nonsense probably null
Pylon UTSW 7 17006349 missense probably damaging 1.00
R0078:Ppp5c UTSW 7 17027725 missense probably benign 0.09
R0366:Ppp5c UTSW 7 17022583 nonsense probably null
R1102:Ppp5c UTSW 7 17022443 missense probably benign 0.01
R1511:Ppp5c UTSW 7 17009982 missense probably damaging 1.00
R1518:Ppp5c UTSW 7 17009936 missense probably damaging 0.97
R1714:Ppp5c UTSW 7 17008703 missense probably benign 0.01
R1754:Ppp5c UTSW 7 17005310 missense probably benign 0.20
R2380:Ppp5c UTSW 7 17006115 missense probably damaging 1.00
R2431:Ppp5c UTSW 7 17015425 missense probably damaging 0.99
R4854:Ppp5c UTSW 7 17009022 missense probably benign 0.00
R4974:Ppp5c UTSW 7 17009936 missense probably damaging 0.97
R5303:Ppp5c UTSW 7 17005284 missense probably benign
R5626:Ppp5c UTSW 7 17027704 missense probably benign
R5785:Ppp5c UTSW 7 17027691 critical splice donor site probably null
R6059:Ppp5c UTSW 7 17027907 unclassified probably benign
R6855:Ppp5c UTSW 7 17006966 missense possibly damaging 0.95
R7760:Ppp5c UTSW 7 17006349 missense probably damaging 1.00
R7885:Ppp5c UTSW 7 17006186 missense possibly damaging 0.86
R8113:Ppp5c UTSW 7 17009007 missense probably benign
R8170:Ppp5c UTSW 7 17007146 missense probably damaging 0.99
R9260:Ppp5c UTSW 7 17006961 missense probably benign 0.06
R9376:Ppp5c UTSW 7 17009924 missense probably damaging 1.00
R9460:Ppp5c UTSW 7 17007212 nonsense probably null
X0026:Ppp5c UTSW 7 17007110 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TACTCTGTAGTGCTTGCCCG -3'
(R):5'- TCTGGATACCCTCTGGTCAC -3'

Sequencing Primer
(F):5'- CGCGTTGCCATGGTTCC -3'
(R):5'- GGATACCCTCTGGTCACCTTGTC -3'
Posted On 2020-09-15