Mutagenetix > Incidental Mutation

Incidental Mutation 'R7922:Arap1'

648447

Institutional Source

Beutler Lab

Gene Symbol

Arap1

Ensembl Gene

ENSMUSG00000032812

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1

Synonyms

Centd2, 2410002L19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7922 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101348067-101412586 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 101404414 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1317 (K1317*)

Ref Sequence

ENSEMBL: ENSMUSP00000081958 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084895] [ENSMUST00000084896] [ENSMUST00000098243] [ENSMUST00000107010]

AlphaFold

Q4LDD4

Predicted Effect

probably null
Transcript: ENSMUST00000084895
AA Change: K1069*

SMART Domains

Protein: ENSMUSP00000081957
Gene: ENSMUSG00000032812
AA Change: K1069*

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC
PH	82	175	2.62e-17	SMART
PH	195	285	3.6e-6	SMART
ArfGap	289	415	2.4e-22	SMART
PH	498	606	1.23e-13	SMART
PH	616	710	1.08e0	SMART
RhoGAP	722	904	1.35e-63	SMART
Pfam:RA	926	1015	1.5e-10	PFAM
PH	1029	1141	8.58e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000084896
AA Change: K1317*

SMART Domains

Protein: ENSMUSP00000081958
Gene: ENSMUSG00000032812
AA Change: K1317*

Domain	Start	End	E-Value	Type
SAM	3	70	1.72e-7	SMART
low complexity region	92	104	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	151	167	N/A	INTRINSIC
low complexity region	197	227	N/A	INTRINSIC
low complexity region	267	285	N/A	INTRINSIC
PH	330	423	2.62e-17	SMART
PH	443	533	3.6e-6	SMART
ArfGap	537	663	2.4e-22	SMART
PH	746	854	1.23e-13	SMART
PH	864	958	1.08e0	SMART
RhoGAP	970	1152	1.35e-63	SMART
Pfam:RA	1174	1263	6.6e-13	PFAM
PH	1277	1400	8e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000098243
AA Change: K603*

SMART Domains

Protein: ENSMUSP00000095844
Gene: ENSMUSG00000032812
AA Change: K603*

Domain	Start	End	E-Value	Type
PH	32	140	1.23e-13	SMART
PH	150	244	1.08e0	SMART
RhoGAP	256	438	1.35e-63	SMART
Pfam:RA	460	549	1.2e-11	PFAM
PH	563	675	8.58e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000107010
AA Change: K1317*

SMART Domains

Protein: ENSMUSP00000102624
Gene: ENSMUSG00000032812
AA Change: K1317*

Domain	Start	End	E-Value	Type
SAM	3	70	1.72e-7	SMART
low complexity region	92	104	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	151	167	N/A	INTRINSIC
low complexity region	197	227	N/A	INTRINSIC
low complexity region	267	285	N/A	INTRINSIC
PH	330	423	2.62e-17	SMART
PH	443	533	3.6e-6	SMART
ArfGap	537	663	2.4e-22	SMART
PH	746	854	1.23e-13	SMART
PH	864	958	1.08e0	SMART
RhoGAP	970	1152	1.35e-63	SMART
Pfam:RA	1174	1263	1.9e-10	PFAM
PH	1277	1389	8.58e-13	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains SAM, ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology (PH) domains. In vitro, this protein displays RHO-GAP and phosphatidylinositol (3,4,5) trisphosphate (PIP3)-dependent ARF-GAP activity. The encoded protein associates with the Golgi, and the ARF-GAP activity mediates changes in the Golgi and the formation of filopodia. It is thought to regulate the cell-specific trafficking of a receptor protein involved in apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	C	T	12: 71,164,406	T638M	possibly damaging	Het
4930546C10Rik	A	G	18: 68,949,996		probably null	Het
Abi3	A	T	11: 95,832,793	Y342N	unknown	Het
Adk	G	A	14: 21,318,043	V195I	probably benign	Het
Ago2	C	T	15: 73,126,526	V268M	possibly damaging	Het
Apaf1	T	C	10: 90,999,753	I1077V	probably benign	Het
Auts2	T	A	5: 131,440,373	D493V		Het
Baz1b	A	T	5: 135,231,679	Q1110L	probably damaging	Het
Brsk2	T	A	7: 141,993,220	S467T	possibly damaging	Het
Btbd9	A	T	17: 30,274,884	M511K	probably benign	Het
Cdh23	T	A	10: 60,382,706	Y1385F	probably benign	Het
Cfap100	A	C	6: 90,403,980	L427V	unknown	Het
Cnga1	A	G	5: 72,604,882	F430L	possibly damaging	Het
Dnhd1	A	T	7: 105,668,514	D472V	probably damaging	Het
Dock2	T	A	11: 34,707,327	E339V	probably benign	Het
Eif3a	A	T	19: 60,775,842	V379E	probably damaging	Het
Erich4	T	A	7: 25,615,743	N36Y	probably damaging	Het
Fam60a	T	A	6: 148,926,146	T125S	probably benign	Het
Frem2	T	C	3: 53,653,304	T1261A	probably damaging	Het
Fzd6	A	T	15: 39,031,108	D223V	probably damaging	Het
Gabra2	A	T	5: 71,007,972	Y218*	probably null	Het
Gcn1l1	G	T	5: 115,614,468	M2177I	probably benign	Het
Ghr	G	A	15: 3,341,074	T103I	possibly damaging	Het
Gipc1	T	C	8: 83,661,228	V79A	probably benign	Het
Gm10031	A	T	1: 156,524,992	L254F	probably damaging	Het
Gm13272	T	A	4: 88,780,340	V164D	probably damaging	Het
Gramd4	C	A	15: 86,131,958	H503Q	probably benign	Het
Gstm4	A	T	3: 108,044,671	M1K	probably null	Het
Heatr5b	T	A	17: 78,760,559	Q1800L	probably benign	Het
Hectd1	T	A	12: 51,790,195	K826*	probably null	Het
Hoxa9	T	C	6: 52,224,309	I251V	possibly damaging	Het
Il2ra	A	T	2: 11,674,366	I46F	possibly damaging	Het
Ints2	T	A	11: 86,244,627	R320S	probably benign	Het
Iscu	A	T	5: 113,774,282	N46I	probably damaging	Het
Iscu	G	A	5: 113,774,349	R60Q	unknown	Het
Kcnk3	A	T	5: 30,588,531	H72L	probably damaging	Het
Kmt2a	T	G	9: 44,842,860	S1228R	unknown	Het
Mbl2	T	A	19: 30,239,238	L150Q	probably damaging	Het
Med13	A	T	11: 86,271,005	F2166Y	probably damaging	Het
Mterf4	A	C	1: 93,301,553	L246*	probably null	Het
Muc16	T	C	9: 18,584,825	Q6690R	probably benign	Het
Myh10	T	A	11: 68,808,893	L1722Q	possibly damaging	Het
Neurod2	T	C	11: 98,327,628	M237V	probably benign	Het
Olfml1	A	G	7: 107,571,149	Y81C	probably damaging	Het
Olfr735	A	G	14: 50,346,415	V9A	probably benign	Het
Pcdhga7	A	T	18: 37,716,173	N411I	probably benign	Het
Pcdhgb8	T	C	18: 37,763,949	F691L	probably benign	Het
Pik3c2a	A	G	7: 116,391,282	V481A	probably damaging	Het
Pik3r6	A	T	11: 68,533,875	R435S	probably benign	Het
Pkd1l1	G	A	11: 8,849,013	H2250Y		Het
Pkd1l1	A	G	11: 8,909,857	S1034P		Het
Plcd1	C	A	9: 119,074,652	R400L	possibly damaging	Het
Ppp2r1a	A	G	17: 20,954,617	T58A	probably benign	Het
Ppp5c	T	C	7: 17,027,800	E5G	possibly damaging	Het
Pradc1	A	C	6: 85,447,968	F82L	probably benign	Het
Prkag3	A	T	1: 74,741,257	S416R	probably benign	Het
Rab3gap2	T	C	1: 185,249,920	C390R	probably benign	Het
Rhot1	A	G	11: 80,265,803	T655A	probably benign	Het
Rorc	A	G	3: 94,391,188	I348V	probably damaging	Het
Ryr1	A	T	7: 29,097,224	V1051E	probably benign	Het
Sema5b	GCAC	GC	16: 35,658,256		probably null	Het
Serpinb3c	G	A	1: 107,272,014	T259I	probably damaging	Het
Sh3gl1	A	T	17: 56,019,438	M70K	probably damaging	Het
Slc7a4	C	T	16: 17,573,366	V607I	probably benign	Het
Spop	A	T	11: 95,471,328	N62Y	probably damaging	Het
Spout1	A	G	2: 30,176,811	F130S	probably benign	Het
Tab1	A	G	15: 80,158,865	H420R	possibly damaging	Het
Tecpr2	CA	C	12: 110,932,642		probably null	Het
Tnxb	G	C	17: 34,714,603	K2332N	probably damaging	Het
Togaram1	T	C	12: 64,967,738	Y588H	probably damaging	Het
Trim71	G	A	9: 114,513,085	R710C	probably damaging	Het
Tsen54	C	T	11: 115,820,782	Q342*	probably null	Het
Ube2r2	T	A	4: 41,190,812	N235K	unknown	Het
Utrn	C	A	10: 12,667,527	K1792N	possibly damaging	Het
Vmn1r122	A	G	7: 21,133,662	I156T	possibly damaging	Het
Vmn1r94	T	C	7: 20,167,711	T223A	possibly damaging	Het
Vmn2r120	G	A	17: 57,524,683	R369W	probably damaging	Het
Vwa7	G	T	17: 35,024,433	A717S	possibly damaging	Het
Zc3h4	T	A	7: 16,425,722	C398S	unknown	Het
Zc3hc1	T	A	6: 30,390,875	E43V	possibly damaging	Het
Zfp101	A	T	17: 33,381,537	V415D	possibly damaging	Het
Zfp553	A	G	7: 127,236,596	H441R	probably damaging	Het

Other mutations in Arap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Arap1	APN	7	101388049	missense	probably damaging	0.96
IGL01311:Arap1	APN	7	101388136	nonsense	probably null
IGL01349:Arap1	APN	7	101387152	missense	possibly damaging	0.84
IGL01521:Arap1	APN	7	101400605	critical splice donor site	probably null
IGL01869:Arap1	APN	7	101400283	missense	probably damaging	1.00
IGL02156:Arap1	APN	7	101388730	unclassified	probably benign
IGL02320:Arap1	APN	7	101385029	missense	probably benign
IGL02478:Arap1	APN	7	101400125	splice site	probably null
R0133:Arap1	UTSW	7	101386229	missense	probably damaging	0.98
R0233:Arap1	UTSW	7	101400241	missense	possibly damaging	0.47
R0233:Arap1	UTSW	7	101400241	missense	possibly damaging	0.47
R0412:Arap1	UTSW	7	101390222	missense	probably damaging	0.98
R0616:Arap1	UTSW	7	101401650	missense	possibly damaging	0.64
R0838:Arap1	UTSW	7	101400412	missense	probably damaging	1.00
R0962:Arap1	UTSW	7	101384914	missense	possibly damaging	0.56
R1186:Arap1	UTSW	7	101404269	splice site	probably benign
R1405:Arap1	UTSW	7	101398436	splice site	probably null
R1405:Arap1	UTSW	7	101398436	splice site	probably null
R1724:Arap1	UTSW	7	101400526	missense	possibly damaging	0.91
R1793:Arap1	UTSW	7	101388622	missense	probably benign
R1959:Arap1	UTSW	7	101373015	missense	probably damaging	1.00
R1960:Arap1	UTSW	7	101373015	missense	probably damaging	1.00
R2020:Arap1	UTSW	7	101401518	missense	probably benign	0.00
R2128:Arap1	UTSW	7	101409320	missense	probably damaging	1.00
R3737:Arap1	UTSW	7	101400277	missense	possibly damaging	0.85
R3851:Arap1	UTSW	7	101390165	nonsense	probably null
R4034:Arap1	UTSW	7	101400277	missense	possibly damaging	0.85
R4386:Arap1	UTSW	7	101385571	missense	probably benign
R4435:Arap1	UTSW	7	101390254	missense	possibly damaging	0.74
R4779:Arap1	UTSW	7	101404367	missense	probably damaging	1.00
R4786:Arap1	UTSW	7	101385005	missense	possibly damaging	0.94
R4850:Arap1	UTSW	7	101398791	missense	probably damaging	1.00
R4942:Arap1	UTSW	7	101401802	missense	possibly damaging	0.95
R5253:Arap1	UTSW	7	101388644	missense	probably benign	0.00
R5342:Arap1	UTSW	7	101404960	missense	probably benign	0.00
R5367:Arap1	UTSW	7	101409130	missense	probably damaging	0.99
R5397:Arap1	UTSW	7	101384912	missense	possibly damaging	0.95
R5968:Arap1	UTSW	7	101394738	missense	probably damaging	1.00
R6052:Arap1	UTSW	7	101404033	missense	probably damaging	1.00
R6574:Arap1	UTSW	7	101404001	missense	probably damaging	1.00
R6645:Arap1	UTSW	7	101408111	missense	possibly damaging	0.57
R7060:Arap1	UTSW	7	101409357	splice site	probably null
R7191:Arap1	UTSW	7	101384992	missense	probably benign	0.31
R7323:Arap1	UTSW	7	101400211	missense	probably damaging	1.00
R7349:Arap1	UTSW	7	101390228	missense	possibly damaging	0.95
R7516:Arap1	UTSW	7	101409331	missense	probably benign	0.00
R8034:Arap1	UTSW	7	101394773	missense	probably damaging	1.00
R8293:Arap1	UTSW	7	101400934	missense	probably benign
R8493:Arap1	UTSW	7	101386518	nonsense	probably null
R8810:Arap1	UTSW	7	101404378	missense	probably damaging	0.99
R8811:Arap1	UTSW	7	101387196	missense	probably damaging	1.00
R8928:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R8930:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R8931:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R8941:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R9014:Arap1	UTSW	7	101404333	missense	probably damaging	1.00
R9144:Arap1	UTSW	7	101398395	missense	probably damaging	1.00
R9164:Arap1	UTSW	7	101391883	nonsense	probably null
R9215:Arap1	UTSW	7	101400007	missense	probably benign	0.23
R9340:Arap1	UTSW	7	101388175	missense	probably damaging	1.00
R9519:Arap1	UTSW	7	101394739	start gained	probably benign
R9790:Arap1	UTSW	7	101388169	missense	probably benign	0.00
R9791:Arap1	UTSW	7	101388169	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTAGGTTGGGCAGTGTAACC -3'
(R):5'- TGTATGATGTCCTGGCCTCAC -3'

Sequencing Primer
(F):5'- AGTGTAACCCATGCCCACTCTG -3'
(R):5'- CACGTAAGGCCTCACGTGGATAG -3'

Posted On

2020-09-15