Mutagenetix > Incidental Mutation

Incidental Mutation 'R7922:Dnhd1'

648448

Institutional Source

Beutler Lab

Gene Symbol

Dnhd1

Ensembl Gene

ENSMUSG00000030882

Gene Name

dynein heavy chain domain 1

Synonyms

8030491N06Rik

MMRRC Submission

045969-MU

Accession Numbers

Variant 1:ENSMUST00000145988; OTTMUST00000062891; Variant 2: ENSMUST00000106773; Variant 3: ENSMUST00000106776; Variant 4: ENSMUST00000163171; Variant 5: ENSMUST00000142363;OTTMUST00000062869; Variant 6: ENSMUST00000142874; OTTMUST00000062870; Variant 7: ENSMUST00000128388; OTTMUST00000062892; MGI:1924755

Essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R7922 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105650827-105721799 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 105668514 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 472 (D472V)

Ref Sequence

ENSEMBL: ENSMUSP00000121261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000142874] [ENSMUST00000145988] [ENSMUST00000210312]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000142874

Predicted Effect

probably damaging
Transcript: ENSMUST00000145988
AA Change: D472V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: D472V

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	102	115	N/A	INTRINSIC
low complexity region	183	191	N/A	INTRINSIC
low complexity region	253	269	N/A	INTRINSIC
low complexity region	943	962	N/A	INTRINSIC
Pfam:DHC_N2	1018	1472	4.6e-50	PFAM
Pfam:AAA_6	1652	1875	2.7e-14	PFAM
low complexity region	1906	1918	N/A	INTRINSIC
Blast:AAA	1993	2196	1e-34	BLAST
Pfam:AAA_7	2362	2610	3.3e-11	PFAM
low complexity region	2697	2714	N/A	INTRINSIC
low complexity region	2722	2733	N/A	INTRINSIC
low complexity region	2800	2810	N/A	INTRINSIC
low complexity region	3116	3134	N/A	INTRINSIC
Pfam:MT	3178	3470	3.9e-16	PFAM
coiled coil region	3590	3642	N/A	INTRINSIC
coiled coil region	3816	3843	N/A	INTRINSIC
Pfam:Dynein_heavy	3976	4746	7.3e-97	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000210312

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	C	T	12: 71,164,406	T638M	possibly damaging	Het
4930546C10Rik	A	G	18: 68,949,996		probably null	Het
Abi3	A	T	11: 95,832,793	Y342N	unknown	Het
Adk	G	A	14: 21,318,043	V195I	probably benign	Het
Ago2	C	T	15: 73,126,526	V268M	possibly damaging	Het
Apaf1	T	C	10: 90,999,753	I1077V	probably benign	Het
Arap1	A	T	7: 101,404,414	K1317*	probably null	Het
Auts2	T	A	5: 131,440,373	D493V		Het
Baz1b	A	T	5: 135,231,679	Q1110L	probably damaging	Het
Brsk2	T	A	7: 141,993,220	S467T	possibly damaging	Het
Btbd9	A	T	17: 30,274,884	M511K	probably benign	Het
Cdh23	T	A	10: 60,382,706	Y1385F	probably benign	Het
Cfap100	A	C	6: 90,403,980	L427V	unknown	Het
Cnga1	A	G	5: 72,604,882	F430L	possibly damaging	Het
Dock2	T	A	11: 34,707,327	E339V	probably benign	Het
Eif3a	A	T	19: 60,775,842	V379E	probably damaging	Het
Erich4	T	A	7: 25,615,743	N36Y	probably damaging	Het
Fam60a	T	A	6: 148,926,146	T125S	probably benign	Het
Frem2	T	C	3: 53,653,304	T1261A	probably damaging	Het
Fzd6	A	T	15: 39,031,108	D223V	probably damaging	Het
Gabra2	A	T	5: 71,007,972	Y218*	probably null	Het
Gcn1l1	G	T	5: 115,614,468	M2177I	probably benign	Het
Ghr	G	A	15: 3,341,074	T103I	possibly damaging	Het
Gipc1	T	C	8: 83,661,228	V79A	probably benign	Het
Gm10031	A	T	1: 156,524,992	L254F	probably damaging	Het
Gm13272	T	A	4: 88,780,340	V164D	probably damaging	Het
Gramd4	C	A	15: 86,131,958	H503Q	probably benign	Het
Gstm4	A	T	3: 108,044,671	M1K	probably null	Het
Heatr5b	T	A	17: 78,760,559	Q1800L	probably benign	Het
Hectd1	T	A	12: 51,790,195	K826*	probably null	Het
Hoxa9	T	C	6: 52,224,309	I251V	possibly damaging	Het
Il2ra	A	T	2: 11,674,366	I46F	possibly damaging	Het
Ints2	T	A	11: 86,244,627	R320S	probably benign	Het
Iscu	A	T	5: 113,774,282	N46I	probably damaging	Het
Iscu	G	A	5: 113,774,349	R60Q	unknown	Het
Kcnk3	A	T	5: 30,588,531	H72L	probably damaging	Het
Kmt2a	T	G	9: 44,842,860	S1228R	unknown	Het
Mbl2	T	A	19: 30,239,238	L150Q	probably damaging	Het
Med13	A	T	11: 86,271,005	F2166Y	probably damaging	Het
Mterf4	A	C	1: 93,301,553	L246*	probably null	Het
Muc16	T	C	9: 18,584,825	Q6690R	probably benign	Het
Myh10	T	A	11: 68,808,893	L1722Q	possibly damaging	Het
Neurod2	T	C	11: 98,327,628	M237V	probably benign	Het
Olfml1	A	G	7: 107,571,149	Y81C	probably damaging	Het
Olfr735	A	G	14: 50,346,415	V9A	probably benign	Het
Pcdhga7	A	T	18: 37,716,173	N411I	probably benign	Het
Pcdhgb8	T	C	18: 37,763,949	F691L	probably benign	Het
Pik3c2a	A	G	7: 116,391,282	V481A	probably damaging	Het
Pik3r6	A	T	11: 68,533,875	R435S	probably benign	Het
Pkd1l1	G	A	11: 8,849,013	H2250Y		Het
Pkd1l1	A	G	11: 8,909,857	S1034P		Het
Plcd1	C	A	9: 119,074,652	R400L	possibly damaging	Het
Ppp2r1a	A	G	17: 20,954,617	T58A	probably benign	Het
Ppp5c	T	C	7: 17,027,800	E5G	possibly damaging	Het
Pradc1	A	C	6: 85,447,968	F82L	probably benign	Het
Prkag3	A	T	1: 74,741,257	S416R	probably benign	Het
Rab3gap2	T	C	1: 185,249,920	C390R	probably benign	Het
Rhot1	A	G	11: 80,265,803	T655A	probably benign	Het
Rorc	A	G	3: 94,391,188	I348V	probably damaging	Het
Ryr1	A	T	7: 29,097,224	V1051E	probably benign	Het
Sema5b	GCAC	GC	16: 35,658,256		probably null	Het
Serpinb3c	G	A	1: 107,272,014	T259I	probably damaging	Het
Sh3gl1	A	T	17: 56,019,438	M70K	probably damaging	Het
Slc7a4	C	T	16: 17,573,366	V607I	probably benign	Het
Spop	A	T	11: 95,471,328	N62Y	probably damaging	Het
Spout1	A	G	2: 30,176,811	F130S	probably benign	Het
Tab1	A	G	15: 80,158,865	H420R	possibly damaging	Het
Tecpr2	CA	C	12: 110,932,642		probably null	Het
Tnxb	G	C	17: 34,714,603	K2332N	probably damaging	Het
Togaram1	T	C	12: 64,967,738	Y588H	probably damaging	Het
Trim71	G	A	9: 114,513,085	R710C	probably damaging	Het
Tsen54	C	T	11: 115,820,782	Q342*	probably null	Het
Ube2r2	T	A	4: 41,190,812	N235K	unknown	Het
Utrn	C	A	10: 12,667,527	K1792N	possibly damaging	Het
Vmn1r122	A	G	7: 21,133,662	I156T	possibly damaging	Het
Vmn1r94	T	C	7: 20,167,711	T223A	possibly damaging	Het
Vmn2r120	G	A	17: 57,524,683	R369W	probably damaging	Het
Vwa7	G	T	17: 35,024,433	A717S	possibly damaging	Het
Zc3h4	T	A	7: 16,425,722	C398S	unknown	Het
Zc3hc1	T	A	6: 30,390,875	E43V	possibly damaging	Het
Zfp101	A	T	17: 33,381,537	V415D	possibly damaging	Het
Zfp553	A	G	7: 127,236,596	H441R	probably damaging	Het

Other mutations in Dnhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Dnhd1	APN	7	105677995	missense	probably damaging	1.00
IGL00516:Dnhd1	APN	7	105657211	missense	possibly damaging	0.52
IGL00576:Dnhd1	APN	7	105692675	missense	probably damaging	1.00
IGL00990:Dnhd1	APN	7	105721688	missense	possibly damaging	0.85
IGL01346:Dnhd1	APN	7	105713909	missense	probably benign
IGL01714:Dnhd1	APN	7	105720942	missense	probably damaging	1.00
IGL01735:Dnhd1	APN	7	105713754	missense	probably benign	0.37
IGL01814:Dnhd1	APN	7	105652030	missense	probably benign
IGL01999:Dnhd1	APN	7	105721215	missense	possibly damaging	0.50
IGL02022:Dnhd1	APN	7	105678309	missense	probably damaging	1.00
IGL02131:Dnhd1	APN	7	105720802	missense	probably damaging	1.00
IGL02156:Dnhd1	APN	7	105721744	missense	probably damaging	1.00
IGL02674:Dnhd1	APN	7	105721481	missense	probably benign	0.00
IGL02966:Dnhd1	APN	7	105720741	missense	probably benign	0.00
IGL03066:Dnhd1	APN	7	105719882	missense	probably damaging	0.99
IGL03298:Dnhd1	APN	7	105714475	missense	probably damaging	0.98
IGL03378:Dnhd1	APN	7	105713733	missense	possibly damaging	0.87
IGL02802:Dnhd1	UTSW	7	105655723	missense	possibly damaging	0.83
R0060:Dnhd1	UTSW	7	105668514	missense	probably damaging	0.99
R0129:Dnhd1	UTSW	7	105720924	missense	probably benign	0.19
R0238:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0238:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0239:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0239:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0384:Dnhd1	UTSW	7	105720114	missense	possibly damaging	0.56
R0453:Dnhd1	UTSW	7	105674444	missense	probably benign	0.00
R0540:Dnhd1	UTSW	7	105720788	missense	probably benign	0.04
R0554:Dnhd1	UTSW	7	105694395	missense	probably benign	0.10
R0576:Dnhd1	UTSW	7	105714045	missense	probably damaging	1.00
R0607:Dnhd1	UTSW	7	105720788	missense	probably benign	0.04
R0631:Dnhd1	UTSW	7	105651624	missense	probably benign	0.17
R0639:Dnhd1	UTSW	7	105696464	missense	possibly damaging	0.95
R0668:Dnhd1	UTSW	7	105695751	missense	probably benign
R0669:Dnhd1	UTSW	7	105693704	missense	probably benign	0.01
R0670:Dnhd1	UTSW	7	105696464	missense	possibly damaging	0.95
R0699:Dnhd1	UTSW	7	105651906	missense	probably damaging	0.98
R1019:Dnhd1	UTSW	7	105709171	missense	probably damaging	1.00
R1144:Dnhd1	UTSW	7	105713031	missense	probably damaging	1.00
R1226:Dnhd1	UTSW	7	105696899	missense	probably damaging	1.00
R1257:Dnhd1	UTSW	7	105694153	missense	probably damaging	1.00
R1391:Dnhd1	UTSW	7	105720124	missense	probably damaging	1.00
R1453:Dnhd1	UTSW	7	105721273	critical splice donor site	probably null
R1501:Dnhd1	UTSW	7	105668463	missense	probably benign	0.00
R1503:Dnhd1	UTSW	7	105693660	missense	possibly damaging	0.67
R1515:Dnhd1	UTSW	7	105704148	missense	probably benign	0.11
R1615:Dnhd1	UTSW	7	105703206	missense	probably benign	0.00
R1615:Dnhd1	UTSW	7	105713706	missense	possibly damaging	0.74
R1656:Dnhd1	UTSW	7	105714281	missense	probably damaging	1.00
R1720:Dnhd1	UTSW	7	105693828	missense	probably benign
R1723:Dnhd1	UTSW	7	105714920	missense	possibly damaging	0.60
R1766:Dnhd1	UTSW	7	105693972	missense	possibly damaging	0.50
R1799:Dnhd1	UTSW	7	105655767	missense	probably benign	0.31
R1860:Dnhd1	UTSW	7	105704205	missense	probably benign
R1920:Dnhd1	UTSW	7	105713407	missense	probably benign	0.00
R1925:Dnhd1	UTSW	7	105652252	missense	probably damaging	1.00
R1925:Dnhd1	UTSW	7	105673854	missense	probably damaging	0.96
R1934:Dnhd1	UTSW	7	105708582	missense	probably benign	0.05
R1935:Dnhd1	UTSW	7	105673976	missense	probably benign	0.09
R1936:Dnhd1	UTSW	7	105673976	missense	probably benign	0.09
R2035:Dnhd1	UTSW	7	105704921	missense	probably damaging	0.99
R2125:Dnhd1	UTSW	7	105677971	missense	probably benign	0.35
R2127:Dnhd1	UTSW	7	105693721	missense	possibly damaging	0.56
R2254:Dnhd1	UTSW	7	105703772	missense	probably damaging	1.00
R2301:Dnhd1	UTSW	7	105705399	missense	probably damaging	1.00
R2316:Dnhd1	UTSW	7	105674421	missense	probably damaging	1.00
R2324:Dnhd1	UTSW	7	105710090	missense	probably damaging	1.00
R2337:Dnhd1	UTSW	7	105703467	missense	probably benign	0.07
R2381:Dnhd1	UTSW	7	105693664	missense	probably benign	0.42
R2394:Dnhd1	UTSW	7	105720231	missense	probably benign	0.19
R2862:Dnhd1	UTSW	7	105712559	missense	probably benign	0.01
R3038:Dnhd1	UTSW	7	105720229	missense	probably damaging	0.99
R3114:Dnhd1	UTSW	7	105696565	critical splice donor site	probably null
R3404:Dnhd1	UTSW	7	105694761	nonsense	probably null
R3405:Dnhd1	UTSW	7	105694761	nonsense	probably null
R3439:Dnhd1	UTSW	7	105694785	missense	probably damaging	1.00
R3959:Dnhd1	UTSW	7	105713122	missense	probably benign	0.21
R4014:Dnhd1	UTSW	7	105714838	missense	probably damaging	0.99
R4084:Dnhd1	UTSW	7	105709588	missense	probably damaging	1.00
R4181:Dnhd1	UTSW	7	105693954	missense	probably damaging	1.00
R4255:Dnhd1	UTSW	7	105712998	missense	probably damaging	1.00
R4302:Dnhd1	UTSW	7	105693954	missense	probably damaging	1.00
R4440:Dnhd1	UTSW	7	105696728	nonsense	probably null
R4565:Dnhd1	UTSW	7	105651956	missense	possibly damaging	0.92
R4569:Dnhd1	UTSW	7	105657166	splice site	probably null
R4584:Dnhd1	UTSW	7	105678049	missense	probably damaging	1.00
R4586:Dnhd1	UTSW	7	105678049	missense	probably damaging	1.00
R4590:Dnhd1	UTSW	7	105714030	missense	probably damaging	1.00
R4593:Dnhd1	UTSW	7	105715446	missense	probably benign	0.02
R4600:Dnhd1	UTSW	7	105703644	missense	probably damaging	1.00
R4705:Dnhd1	UTSW	7	105655741	missense	probably damaging	1.00
R4731:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4732:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4733:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4786:Dnhd1	UTSW	7	105674444	missense	probably benign	0.00
R4791:Dnhd1	UTSW	7	105721117	missense	probably damaging	1.00
R4811:Dnhd1	UTSW	7	105714281	missense	probably damaging	0.99
R4822:Dnhd1	UTSW	7	105703964	missense	probably benign	0.00
R4886:Dnhd1	UTSW	7	105714808	missense	probably benign	0.00
R4890:Dnhd1	UTSW	7	105656957	missense	possibly damaging	0.47
R4973:Dnhd1	UTSW	7	105713633	missense	probably benign	0.24
R5007:Dnhd1	UTSW	7	105713076	missense	probably damaging	1.00
R5048:Dnhd1	UTSW	7	105693697	missense	probably benign	0.01
R5151:Dnhd1	UTSW	7	105713440	missense	probably benign	0.22
R5179:Dnhd1	UTSW	7	105714552	missense	probably damaging	1.00
R5182:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5183:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5185:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5209:Dnhd1	UTSW	7	105696460	missense	probably benign	0.00
R5225:Dnhd1	UTSW	7	105703923	missense	possibly damaging	0.73
R5250:Dnhd1	UTSW	7	105685761	missense	probably damaging	1.00
R5257:Dnhd1	UTSW	7	105674037	missense	probably benign
R5258:Dnhd1	UTSW	7	105674037	missense	probably benign
R5273:Dnhd1	UTSW	7	105714482	missense	probably damaging	0.99
R5288:Dnhd1	UTSW	7	105714437	missense	possibly damaging	0.94
R5396:Dnhd1	UTSW	7	105713684	missense	probably benign	0.00
R5453:Dnhd1	UTSW	7	105710123	missense	probably damaging	1.00
R5511:Dnhd1	UTSW	7	105714156	missense	probably damaging	1.00
R5518:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5523:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5528:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5529:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5561:Dnhd1	UTSW	7	105714821	missense	probably damaging	0.99
R5681:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5682:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5683:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5684:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5686:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5697:Dnhd1	UTSW	7	105674188	missense	probably damaging	1.00
R5789:Dnhd1	UTSW	7	105705010	missense	possibly damaging	0.50
R5790:Dnhd1	UTSW	7	105655774	missense	probably damaging	1.00
R5814:Dnhd1	UTSW	7	105719895	missense	possibly damaging	0.69
R5828:Dnhd1	UTSW	7	105720181	missense	probably benign	0.00
R5852:Dnhd1	UTSW	7	105695748	missense	probably damaging	1.00
R5883:Dnhd1	UTSW	7	105720504	missense	probably damaging	0.98
R6115:Dnhd1	UTSW	7	105713987	missense	probably benign	0.00
R6119:Dnhd1	UTSW	7	105709440	missense	probably benign	0.18
R6212:Dnhd1	UTSW	7	105704048	missense	probably damaging	1.00
R6243:Dnhd1	UTSW	7	105652009	missense	probably damaging	1.00
R6265:Dnhd1	UTSW	7	105693370	missense	probably benign	0.07
R6332:Dnhd1	UTSW	7	105694066	missense	probably benign	0.02
R6344:Dnhd1	UTSW	7	105694610	missense	probably benign	0.38
R6477:Dnhd1	UTSW	7	105677886	missense	probably benign	0.05
R6642:Dnhd1	UTSW	7	105703799	missense	probably benign
R6663:Dnhd1	UTSW	7	105685692	splice site	probably null
R6730:Dnhd1	UTSW	7	105703875	missense	probably benign	0.00
R6748:Dnhd1	UTSW	7	105720637	missense	probably benign	0.03
R6833:Dnhd1	UTSW	7	105703373	missense	probably benign	0.01
R6850:Dnhd1	UTSW	7	105719930	missense	possibly damaging	0.68
R6853:Dnhd1	UTSW	7	105703728	missense	probably benign
R6860:Dnhd1	UTSW	7	105678266	missense	probably benign
R6898:Dnhd1	UTSW	7	105687377	missense	probably damaging	0.99
R6927:Dnhd1	UTSW	7	105715563	missense	probably damaging	1.00
R6952:Dnhd1	UTSW	7	105713688	missense	probably damaging	1.00
R6987:Dnhd1	UTSW	7	105704585	missense	probably damaging	0.98
R6988:Dnhd1	UTSW	7	105714210	missense	probably damaging	1.00
R7022:Dnhd1	UTSW	7	105720798	missense	probably benign	0.36
R7053:Dnhd1	UTSW	7	105694954	missense	probably damaging	1.00
R7085:Dnhd1	UTSW	7	105715261	missense	probably benign	0.26
R7086:Dnhd1	UTSW	7	105708532	missense	probably benign	0.03
R7112:Dnhd1	UTSW	7	105713985	missense	probably damaging	1.00
R7140:Dnhd1	UTSW	7	105693766	missense	probably benign	0.00
R7151:Dnhd1	UTSW	7	105710027	missense	probably benign	0.03
R7178:Dnhd1	UTSW	7	105694993	missense	probably damaging	0.98
R7326:Dnhd1	UTSW	7	105720930	missense	probably damaging	0.96
R7345:Dnhd1	UTSW	7	105703967	missense	probably benign	0.17
R7349:Dnhd1	UTSW	7	105710123	missense	probably damaging	1.00
R7397:Dnhd1	UTSW	7	105705297	missense	possibly damaging	0.87
R7520:Dnhd1	UTSW	7	105696048	missense	probably benign	0.07
R7536:Dnhd1	UTSW	7	105709561	missense	probably damaging	1.00
R7539:Dnhd1	UTSW	7	105720912	missense	probably damaging	1.00
R7541:Dnhd1	UTSW	7	105678309	missense	probably damaging	1.00
R7619:Dnhd1	UTSW	7	105674268	missense	probably benign	0.01
R7676:Dnhd1	UTSW	7	105684087	missense	probably benign	0.09
R7689:Dnhd1	UTSW	7	105713963	missense	probably benign	0.07
R7712:Dnhd1	UTSW	7	105651624	missense	probably benign	0.17
R7729:Dnhd1	UTSW	7	105705265	missense	probably damaging	1.00
R7767:Dnhd1	UTSW	7	105694610	missense	probably benign	0.38
R7768:Dnhd1	UTSW	7	105721095	missense	possibly damaging	0.87
R7779:Dnhd1	UTSW	7	105677915	missense	probably benign	0.01
R7879:Dnhd1	UTSW	7	105703439	missense	probably benign	0.09
R7951:Dnhd1	UTSW	7	105678004	missense	probably damaging	1.00
R8259:Dnhd1	UTSW	7	105694788	missense	probably benign	0.38
R8350:Dnhd1	UTSW	7	105678024	missense	probably damaging	0.99
R8380:Dnhd1	UTSW	7	105677866	missense	probably benign	0.31
R8392:Dnhd1	UTSW	7	105703343	missense	possibly damaging	0.84
R8478:Dnhd1	UTSW	7	105682794	missense	probably benign	0.00
R8708:Dnhd1	UTSW	7	105694280	nonsense	probably null
R8767:Dnhd1	UTSW	7	105652123	missense	probably damaging	1.00
R8825:Dnhd1	UTSW	7	105693967	missense	possibly damaging	0.95
R8849:Dnhd1	UTSW	7	105721516	missense	probably benign	0.00
R8903:Dnhd1	UTSW	7	105713648	nonsense	probably null
R8910:Dnhd1	UTSW	7	105683697	missense	possibly damaging	0.92
R8940:Dnhd1	UTSW	7	105714647	intron	probably benign
R8954:Dnhd1	UTSW	7	105694779	missense	probably benign	0.35
R8956:Dnhd1	UTSW	7	105692645	missense	probably damaging	0.99
R8971:Dnhd1	UTSW	7	105709321	nonsense	probably null
R8996:Dnhd1	UTSW	7	105674035	missense	probably damaging	1.00
R9051:Dnhd1	UTSW	7	105692726	missense	possibly damaging	0.54
R9058:Dnhd1	UTSW	7	105684063	missense	probably benign	0.01
R9109:Dnhd1	UTSW	7	105683966	missense	probably damaging	0.98
R9284:Dnhd1	UTSW	7	105651884	missense	probably damaging	1.00
R9295:Dnhd1	UTSW	7	105714141	missense	probably benign
R9298:Dnhd1	UTSW	7	105683966	missense	probably damaging	0.98
R9299:Dnhd1	UTSW	7	105720599	missense	probably benign	0.00
R9308:Dnhd1	UTSW	7	105704277	missense	probably damaging	1.00
R9337:Dnhd1	UTSW	7	105720599	missense	probably benign	0.00
R9385:Dnhd1	UTSW	7	105712765	missense	probably damaging	1.00
R9463:Dnhd1	UTSW	7	105657247	missense	probably benign	0.00
R9463:Dnhd1	UTSW	7	105695016	missense	probably benign
R9476:Dnhd1	UTSW	7	105703682	missense	possibly damaging	0.74
R9489:Dnhd1	UTSW	7	105651597	missense	probably benign
R9500:Dnhd1	UTSW	7	105704502	missense	probably benign
R9510:Dnhd1	UTSW	7	105703682	missense	possibly damaging	0.74
R9513:Dnhd1	UTSW	7	105704972	missense	probably damaging	1.00
R9537:Dnhd1	UTSW	7	105695533	missense	probably damaging	0.99
R9567:Dnhd1	UTSW	7	105704266	missense	probably benign	0.03
R9622:Dnhd1	UTSW	7	105704135	missense	probably benign
R9623:Dnhd1	UTSW	7	105686566	missense	probably damaging	1.00
R9623:Dnhd1	UTSW	7	105694927	missense	probably damaging	1.00
R9674:Dnhd1	UTSW	7	105714222	missense	probably damaging	1.00
R9756:Dnhd1	UTSW	7	105703928	missense	probably benign	0.19
R9777:Dnhd1	UTSW	7	105720249	missense	probably benign	0.14
R9778:Dnhd1	UTSW	7	105704033	missense	probably benign
R9781:Dnhd1	UTSW	7	105703710	missense	probably benign	0.31
R9796:Dnhd1	UTSW	7	105693330	missense	probably damaging	1.00
Z1088:Dnhd1	UTSW	7	105712727	missense	probably benign	0.00
Z1176:Dnhd1	UTSW	7	105668547	missense	probably damaging	0.98
Z1176:Dnhd1	UTSW	7	105678299	missense	probably benign
Z1176:Dnhd1	UTSW	7	105703036	critical splice acceptor site	probably null
Z1176:Dnhd1	UTSW	7	105703580	frame shift	probably null
Z1177:Dnhd1	UTSW	7	105682841	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AACTTTCTGGTCTTAAGAAGCTGC -3'
(R):5'- GGGTCCCAGAAGTAACTTAACG -3'

Sequencing Primer
(F):5'- CTGGTCTTAAGAAGCTGCTGTTG -3'
(R):5'- TCCCAGAAGTAACTTAACGAAGAG -3'

Posted On

2020-09-15