Incidental Mutation 'R7922:Muc16'
ID 648454
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Name mucin 16
Synonyms 1110008I14Rik, LOC385009, Gm21044
MMRRC Submission 045969-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.219) question?
Stock # R7922 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 18406751-18585826 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18496121 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 6690 (Q6690R)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208663]
AlphaFold no structure available at present
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000208663
AA Change: Q6690R

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,211,180 (GRCm39) T638M possibly damaging Het
4930546C10Rik A G 18: 69,083,067 (GRCm39) probably null Het
Abi3 A T 11: 95,723,619 (GRCm39) Y342N unknown Het
Adk G A 14: 21,368,111 (GRCm39) V195I probably benign Het
Ago2 C T 15: 72,998,375 (GRCm39) V268M possibly damaging Het
Apaf1 T C 10: 90,835,615 (GRCm39) I1077V probably benign Het
Arap1 A T 7: 101,053,621 (GRCm39) K1317* probably null Het
Auts2 T A 5: 131,469,211 (GRCm39) D493V Het
Baz1b A T 5: 135,260,533 (GRCm39) Q1110L probably damaging Het
Brsk2 T A 7: 141,546,957 (GRCm39) S467T possibly damaging Het
Btbd9 A T 17: 30,493,858 (GRCm39) M511K probably benign Het
Cdh23 T A 10: 60,218,485 (GRCm39) Y1385F probably benign Het
Cfap100 A C 6: 90,380,962 (GRCm39) L427V unknown Het
Cnga1 A G 5: 72,762,225 (GRCm39) F430L possibly damaging Het
Csnk2a1-ps3 A T 1: 156,352,562 (GRCm39) L254F probably damaging Het
Dnhd1 A T 7: 105,317,721 (GRCm39) D472V probably damaging Het
Dock2 T A 11: 34,598,154 (GRCm39) E339V probably benign Het
Eif3a A T 19: 60,764,280 (GRCm39) V379E probably damaging Het
Erich4 T A 7: 25,315,168 (GRCm39) N36Y probably damaging Het
Frem2 T C 3: 53,560,725 (GRCm39) T1261A probably damaging Het
Fzd6 A T 15: 38,894,503 (GRCm39) D223V probably damaging Het
Gabra2 A T 5: 71,165,315 (GRCm39) Y218* probably null Het
Gcn1 G T 5: 115,752,527 (GRCm39) M2177I probably benign Het
Ghr G A 15: 3,370,556 (GRCm39) T103I possibly damaging Het
Gipc1 T C 8: 84,387,857 (GRCm39) V79A probably benign Het
Gm13272 T A 4: 88,698,577 (GRCm39) V164D probably damaging Het
Gramd4 C A 15: 86,016,159 (GRCm39) H503Q probably benign Het
Gstm4 A T 3: 107,951,987 (GRCm39) M1K probably null Het
Heatr5b T A 17: 79,067,988 (GRCm39) Q1800L probably benign Het
Hectd1 T A 12: 51,836,978 (GRCm39) K826* probably null Het
Hoxa9 T C 6: 52,201,289 (GRCm39) I251V possibly damaging Het
Il2ra A T 2: 11,679,177 (GRCm39) I46F possibly damaging Het
Ints2 T A 11: 86,135,453 (GRCm39) R320S probably benign Het
Iscu A T 5: 113,912,343 (GRCm39) N46I probably damaging Het
Iscu G A 5: 113,912,410 (GRCm39) R60Q unknown Het
Kcnk3 A T 5: 30,745,875 (GRCm39) H72L probably damaging Het
Kmt2a T G 9: 44,754,157 (GRCm39) S1228R unknown Het
Mbl2 T A 19: 30,216,638 (GRCm39) L150Q probably damaging Het
Med13 A T 11: 86,161,831 (GRCm39) F2166Y probably damaging Het
Mterf4 A C 1: 93,229,275 (GRCm39) L246* probably null Het
Myh10 T A 11: 68,699,719 (GRCm39) L1722Q possibly damaging Het
Neurod2 T C 11: 98,218,454 (GRCm39) M237V probably benign Het
Olfml1 A G 7: 107,170,356 (GRCm39) Y81C probably damaging Het
Or4q3 A G 14: 50,583,872 (GRCm39) V9A probably benign Het
Pcdhga7 A T 18: 37,849,226 (GRCm39) N411I probably benign Het
Pcdhgb8 T C 18: 37,897,002 (GRCm39) F691L probably benign Het
Pik3c2a A G 7: 115,990,517 (GRCm39) V481A probably damaging Het
Pik3r6 A T 11: 68,424,701 (GRCm39) R435S probably benign Het
Pkd1l1 G A 11: 8,799,013 (GRCm39) H2250Y Het
Pkd1l1 A G 11: 8,859,857 (GRCm39) S1034P Het
Plcd1 C A 9: 118,903,720 (GRCm39) R400L possibly damaging Het
Ppp2r1a A G 17: 21,174,879 (GRCm39) T58A probably benign Het
Ppp5c T C 7: 16,761,725 (GRCm39) E5G possibly damaging Het
Pradc1 A C 6: 85,424,950 (GRCm39) F82L probably benign Het
Prkag3 A T 1: 74,780,416 (GRCm39) S416R probably benign Het
Rab3gap2 T C 1: 184,982,117 (GRCm39) C390R probably benign Het
Rhot1 A G 11: 80,156,629 (GRCm39) T655A probably benign Het
Rorc A G 3: 94,298,495 (GRCm39) I348V probably damaging Het
Ryr1 A T 7: 28,796,649 (GRCm39) V1051E probably benign Het
Sema5b GCAC GC 16: 35,478,626 (GRCm39) probably null Het
Serpinb3c G A 1: 107,199,744 (GRCm39) T259I probably damaging Het
Sh3gl1 A T 17: 56,326,438 (GRCm39) M70K probably damaging Het
Sinhcaf T A 6: 148,827,644 (GRCm39) T125S probably benign Het
Slc7a4 C T 16: 17,391,230 (GRCm39) V607I probably benign Het
Spop A T 11: 95,362,154 (GRCm39) N62Y probably damaging Het
Spout1 A G 2: 30,066,823 (GRCm39) F130S probably benign Het
Tab1 A G 15: 80,043,066 (GRCm39) H420R possibly damaging Het
Tecpr2 CA C 12: 110,899,076 (GRCm39) probably null Het
Tnxb G C 17: 34,933,577 (GRCm39) K2332N probably damaging Het
Togaram1 T C 12: 65,014,512 (GRCm39) Y588H probably damaging Het
Trim71 G A 9: 114,342,153 (GRCm39) R710C probably damaging Het
Tsen54 C T 11: 115,711,608 (GRCm39) Q342* probably null Het
Ube2r2 T A 4: 41,190,812 (GRCm39) N235K unknown Het
Utrn C A 10: 12,543,271 (GRCm39) K1792N possibly damaging Het
Vmn1r122 A G 7: 20,867,587 (GRCm39) I156T possibly damaging Het
Vmn1r94 T C 7: 19,901,636 (GRCm39) T223A possibly damaging Het
Vmn2r120 G A 17: 57,831,683 (GRCm39) R369W probably damaging Het
Vwa7 G T 17: 35,243,409 (GRCm39) A717S possibly damaging Het
Zc3h4 T A 7: 16,159,647 (GRCm39) C398S unknown Het
Zc3hc1 T A 6: 30,390,874 (GRCm39) E43V possibly damaging Het
Zfp101 A T 17: 33,600,511 (GRCm39) V415D possibly damaging Het
Zfp553 A G 7: 126,835,768 (GRCm39) H441R probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18,419,803 (GRCm39) missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18,406,839 (GRCm39) missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18,409,996 (GRCm39) missense probably damaging 0.99
IGL02553:Muc16 APN 9 18,409,849 (GRCm39) critical splice donor site probably null
Brimming UTSW 9 18,503,976 (GRCm39) missense probably damaging 0.99
R7038_muc16_859 UTSW 9 18,531,764 (GRCm39) missense probably damaging 0.99
Runneymeade UTSW 9 18,490,613 (GRCm39) critical splice donor site probably null
slimey UTSW 9 18,501,994 (GRCm39) missense probably damaging 1.00
viscous UTSW 9 18,556,028 (GRCm39) missense unknown
R0400:Muc16 UTSW 9 18,421,830 (GRCm39) missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18,421,773 (GRCm39) missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18,408,729 (GRCm39) missense probably damaging 1.00
R3196:Muc16 UTSW 9 18,409,126 (GRCm39) missense probably damaging 1.00
R5982:Muc16 UTSW 9 18,558,442 (GRCm39) missense unknown
R5990:Muc16 UTSW 9 18,570,539 (GRCm39) missense unknown
R6024:Muc16 UTSW 9 18,557,967 (GRCm39) missense unknown
R6026:Muc16 UTSW 9 18,571,154 (GRCm39) missense unknown
R6028:Muc16 UTSW 9 18,568,472 (GRCm39) missense unknown
R6083:Muc16 UTSW 9 18,568,508 (GRCm39) missense unknown
R6089:Muc16 UTSW 9 18,554,548 (GRCm39) missense unknown
R6109:Muc16 UTSW 9 18,566,655 (GRCm39) missense unknown
R6127:Muc16 UTSW 9 18,569,174 (GRCm39) missense unknown
R6130:Muc16 UTSW 9 18,501,994 (GRCm39) missense probably damaging 1.00
R6146:Muc16 UTSW 9 18,409,093 (GRCm39) missense probably damaging 0.98
R6161:Muc16 UTSW 9 18,559,114 (GRCm39) missense unknown
R6164:Muc16 UTSW 9 18,469,675 (GRCm39) missense probably damaging 1.00
R6185:Muc16 UTSW 9 18,565,769 (GRCm39) missense unknown
R6192:Muc16 UTSW 9 18,569,985 (GRCm39) missense unknown
R6217:Muc16 UTSW 9 18,566,742 (GRCm39) missense unknown
R6232:Muc16 UTSW 9 18,568,294 (GRCm39) missense unknown
R6246:Muc16 UTSW 9 18,488,363 (GRCm39) splice site probably null
R6255:Muc16 UTSW 9 18,566,895 (GRCm39) missense unknown
R6280:Muc16 UTSW 9 18,490,613 (GRCm39) critical splice donor site probably null
R6286:Muc16 UTSW 9 18,555,685 (GRCm39) missense unknown
R6287:Muc16 UTSW 9 18,570,330 (GRCm39) missense unknown
R6307:Muc16 UTSW 9 18,558,884 (GRCm39) missense unknown
R6310:Muc16 UTSW 9 18,553,246 (GRCm39) missense probably benign 0.00
R6316:Muc16 UTSW 9 18,553,115 (GRCm39) missense probably benign 0.01
R6335:Muc16 UTSW 9 18,572,004 (GRCm39) missense unknown
R6345:Muc16 UTSW 9 18,566,222 (GRCm39) missense unknown
R6349:Muc16 UTSW 9 18,568,625 (GRCm39) missense unknown
R6366:Muc16 UTSW 9 18,557,340 (GRCm39) missense unknown
R6393:Muc16 UTSW 9 18,558,695 (GRCm39) nonsense probably null
R6440:Muc16 UTSW 9 18,552,655 (GRCm39) missense probably benign 0.01
R6458:Muc16 UTSW 9 18,553,017 (GRCm39) missense probably benign 0.01
R6460:Muc16 UTSW 9 18,551,812 (GRCm39) missense probably benign 0.01
R6481:Muc16 UTSW 9 18,461,973 (GRCm39) critical splice donor site probably null
R6539:Muc16 UTSW 9 18,548,621 (GRCm39) missense probably benign 0.25
R6551:Muc16 UTSW 9 18,473,858 (GRCm39) missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18,478,011 (GRCm39) missense probably benign 0.18
R6601:Muc16 UTSW 9 18,548,866 (GRCm39) missense probably benign 0.10
R6602:Muc16 UTSW 9 18,520,772 (GRCm39) splice site probably null
R6615:Muc16 UTSW 9 18,558,484 (GRCm39) missense unknown
R6625:Muc16 UTSW 9 18,571,574 (GRCm39) missense unknown
R6668:Muc16 UTSW 9 18,551,681 (GRCm39) missense probably benign 0.03
R6697:Muc16 UTSW 9 18,552,587 (GRCm39) missense probably benign 0.01
R6710:Muc16 UTSW 9 18,553,366 (GRCm39) missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18,477,986 (GRCm39) critical splice donor site probably null
R6789:Muc16 UTSW 9 18,471,282 (GRCm39) missense probably benign 0.40
R6806:Muc16 UTSW 9 18,449,206 (GRCm39) critical splice donor site probably null
R6874:Muc16 UTSW 9 18,570,065 (GRCm39) nonsense probably null
R6894:Muc16 UTSW 9 18,406,872 (GRCm39) missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18,553,959 (GRCm39) missense unknown
R6919:Muc16 UTSW 9 18,571,595 (GRCm39) missense unknown
R6939:Muc16 UTSW 9 18,549,833 (GRCm39) missense probably benign 0.04
R6953:Muc16 UTSW 9 18,551,825 (GRCm39) missense probably benign 0.01
R6956:Muc16 UTSW 9 18,556,322 (GRCm39) missense unknown
R6977:Muc16 UTSW 9 18,556,633 (GRCm39) missense unknown
R6996:Muc16 UTSW 9 18,557,193 (GRCm39) missense unknown
R7011:Muc16 UTSW 9 18,548,839 (GRCm39) missense probably benign 0.10
R7011:Muc16 UTSW 9 18,548,747 (GRCm39) missense probably benign 0.26
R7012:Muc16 UTSW 9 18,406,914 (GRCm39) critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18,569,532 (GRCm39) missense unknown
R7021:Muc16 UTSW 9 18,462,127 (GRCm39) splice site probably null
R7021:Muc16 UTSW 9 18,466,215 (GRCm39) missense unknown
R7038:Muc16 UTSW 9 18,531,764 (GRCm39) missense probably damaging 0.99
R7057:Muc16 UTSW 9 18,557,375 (GRCm39) missense unknown
R7058:Muc16 UTSW 9 18,551,051 (GRCm39) missense probably benign 0.10
R7066:Muc16 UTSW 9 18,569,317 (GRCm39) missense unknown
R7067:Muc16 UTSW 9 18,569,547 (GRCm39) missense unknown
R7070:Muc16 UTSW 9 18,557,219 (GRCm39) nonsense probably null
R7074:Muc16 UTSW 9 18,566,946 (GRCm39) missense unknown
R7085:Muc16 UTSW 9 18,556,145 (GRCm39) missense unknown
R7088:Muc16 UTSW 9 18,503,976 (GRCm39) missense probably damaging 0.99
R7107:Muc16 UTSW 9 18,548,594 (GRCm39) missense probably benign 0.10
R7108:Muc16 UTSW 9 18,566,529 (GRCm39) missense unknown
R7126:Muc16 UTSW 9 18,552,512 (GRCm39) missense probably benign 0.01
R7128:Muc16 UTSW 9 18,554,300 (GRCm39) missense unknown
R7145:Muc16 UTSW 9 18,566,876 (GRCm39) missense unknown
R7179:Muc16 UTSW 9 18,553,304 (GRCm39) missense probably benign 0.00
R7194:Muc16 UTSW 9 18,585,750 (GRCm39) missense unknown
R7211:Muc16 UTSW 9 18,409,866 (GRCm39) missense probably damaging 1.00
R7213:Muc16 UTSW 9 18,552,712 (GRCm39) missense probably benign 0.01
R7217:Muc16 UTSW 9 18,555,372 (GRCm39) nonsense probably null
R7221:Muc16 UTSW 9 18,553,495 (GRCm39) missense probably benign 0.04
R7265:Muc16 UTSW 9 18,567,768 (GRCm39) missense unknown
R7326:Muc16 UTSW 9 18,496,309 (GRCm39) missense probably benign 0.03
R7359:Muc16 UTSW 9 18,554,316 (GRCm39) missense unknown
R7387:Muc16 UTSW 9 18,553,016 (GRCm39) missense probably benign 0.01
R7391:Muc16 UTSW 9 18,550,832 (GRCm39) missense probably benign 0.04
R7398:Muc16 UTSW 9 18,549,038 (GRCm39) missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18,553,258 (GRCm39) missense probably benign 0.01
R7431:Muc16 UTSW 9 18,519,289 (GRCm39) missense
R7484:Muc16 UTSW 9 18,558,064 (GRCm39) missense unknown
R7487:Muc16 UTSW 9 18,496,095 (GRCm39) missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18,556,385 (GRCm39) missense unknown
R7515:Muc16 UTSW 9 18,550,958 (GRCm39) missense probably benign 0.00
R7537:Muc16 UTSW 9 18,549,431 (GRCm39) missense probably benign 0.06
R7538:Muc16 UTSW 9 18,566,747 (GRCm39) missense unknown
R7538:Muc16 UTSW 9 18,553,427 (GRCm39) missense probably benign 0.10
R7543:Muc16 UTSW 9 18,556,028 (GRCm39) missense unknown
R7566:Muc16 UTSW 9 18,549,925 (GRCm39) missense probably benign 0.00
R7581:Muc16 UTSW 9 18,556,910 (GRCm39) missense unknown
R7594:Muc16 UTSW 9 18,556,358 (GRCm39) missense unknown
R7629:Muc16 UTSW 9 18,478,081 (GRCm39) missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18,519,018 (GRCm39) missense probably benign 0.08
R7666:Muc16 UTSW 9 18,469,723 (GRCm39) missense probably damaging 1.00
R7703:Muc16 UTSW 9 18,516,578 (GRCm39) missense
R7727:Muc16 UTSW 9 18,571,538 (GRCm39) missense unknown
R7743:Muc16 UTSW 9 18,568,773 (GRCm39) missense unknown
R7744:Muc16 UTSW 9 18,496,392 (GRCm39) critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18,491,870 (GRCm39) missense probably damaging 1.00
R7769:Muc16 UTSW 9 18,571,803 (GRCm39) missense unknown
R7805:Muc16 UTSW 9 18,549,789 (GRCm39) missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18,506,519 (GRCm39) missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18,552,069 (GRCm39) missense probably benign 0.01
R7849:Muc16 UTSW 9 18,551,801 (GRCm39) missense probably benign 0.01
R7884:Muc16 UTSW 9 18,553,990 (GRCm39) missense unknown
R7885:Muc16 UTSW 9 18,550,760 (GRCm39) missense probably benign 0.10
R7886:Muc16 UTSW 9 18,497,278 (GRCm39) missense probably benign 0.03
R7899:Muc16 UTSW 9 18,551,993 (GRCm39) missense probably benign 0.01
R7904:Muc16 UTSW 9 18,566,946 (GRCm39) missense unknown
R7921:Muc16 UTSW 9 18,570,614 (GRCm39) missense unknown
R7948:Muc16 UTSW 9 18,553,786 (GRCm39) missense unknown
R7957:Muc16 UTSW 9 18,554,767 (GRCm39) missense unknown
R7972:Muc16 UTSW 9 18,557,060 (GRCm39) nonsense probably null
R7992:Muc16 UTSW 9 18,567,725 (GRCm39) missense unknown
R7998:Muc16 UTSW 9 18,551,188 (GRCm39) missense probably benign 0.04
R8014:Muc16 UTSW 9 18,566,171 (GRCm39) missense unknown
R8033:Muc16 UTSW 9 18,547,902 (GRCm39) missense probably benign 0.26
R8052:Muc16 UTSW 9 18,570,347 (GRCm39) missense unknown
R8058:Muc16 UTSW 9 18,571,298 (GRCm39) nonsense probably null
R8088:Muc16 UTSW 9 18,430,596 (GRCm39) nonsense probably null
R8095:Muc16 UTSW 9 18,496,126 (GRCm39) nonsense probably null
R8111:Muc16 UTSW 9 18,503,925 (GRCm39) missense possibly damaging 0.55
R8116:Muc16 UTSW 9 18,570,033 (GRCm39) missense unknown
R8117:Muc16 UTSW 9 18,420,206 (GRCm39) nonsense probably null
R8137:Muc16 UTSW 9 18,556,972 (GRCm39) missense unknown
R8196:Muc16 UTSW 9 18,556,630 (GRCm39) missense unknown
R8218:Muc16 UTSW 9 18,548,315 (GRCm39) missense possibly damaging 0.48
R8285:Muc16 UTSW 9 18,554,273 (GRCm39) missense unknown
R8313:Muc16 UTSW 9 18,436,443 (GRCm39) missense possibly damaging 0.85
R8317:Muc16 UTSW 9 18,569,339 (GRCm39) missense unknown
R8342:Muc16 UTSW 9 18,569,981 (GRCm39) missense unknown
R8351:Muc16 UTSW 9 18,571,181 (GRCm39) missense unknown
R8356:Muc16 UTSW 9 18,570,074 (GRCm39) missense unknown
R8360:Muc16 UTSW 9 18,436,554 (GRCm39) missense probably benign 0.01
R8418:Muc16 UTSW 9 18,430,926 (GRCm39) missense possibly damaging 0.94
R8420:Muc16 UTSW 9 18,448,807 (GRCm39) missense probably damaging 0.99
R8437:Muc16 UTSW 9 18,569,220 (GRCm39) missense unknown
R8463:Muc16 UTSW 9 18,570,435 (GRCm39) missense unknown
R8466:Muc16 UTSW 9 18,554,444 (GRCm39) missense unknown
R8512:Muc16 UTSW 9 18,549,488 (GRCm39) missense probably benign 0.01
R8518:Muc16 UTSW 9 18,430,927 (GRCm39) missense probably benign 0.12
R8556:Muc16 UTSW 9 18,552,233 (GRCm39) missense probably benign 0.01
R8679:Muc16 UTSW 9 18,557,744 (GRCm39) missense unknown
R8680:Muc16 UTSW 9 18,556,015 (GRCm39) missense unknown
R8720:Muc16 UTSW 9 18,552,896 (GRCm39) missense probably benign 0.01
R8729:Muc16 UTSW 9 18,571,346 (GRCm39) missense unknown
R8736:Muc16 UTSW 9 18,462,139 (GRCm39) nonsense probably null
R8739:Muc16 UTSW 9 18,548,594 (GRCm39) missense probably benign 0.10
R8807:Muc16 UTSW 9 18,567,353 (GRCm39) missense unknown
R8830:Muc16 UTSW 9 18,557,365 (GRCm39) missense unknown
R8871:Muc16 UTSW 9 18,567,344 (GRCm39) missense unknown
R8884:Muc16 UTSW 9 18,555,496 (GRCm39) missense unknown
R8923:Muc16 UTSW 9 18,549,972 (GRCm39) missense probably benign 0.01
R8948:Muc16 UTSW 9 18,558,529 (GRCm39) missense unknown
R8949:Muc16 UTSW 9 18,432,221 (GRCm39) critical splice donor site probably null
R8987:Muc16 UTSW 9 18,462,981 (GRCm39) nonsense probably null
R8997:Muc16 UTSW 9 18,518,763 (GRCm39) intron probably benign
R9013:Muc16 UTSW 9 18,424,069 (GRCm39) missense possibly damaging 0.94
R9020:Muc16 UTSW 9 18,550,015 (GRCm39) small insertion probably benign
R9036:Muc16 UTSW 9 18,555,975 (GRCm39) missense unknown
R9040:Muc16 UTSW 9 18,556,082 (GRCm39) nonsense probably null
R9065:Muc16 UTSW 9 18,554,305 (GRCm39) missense unknown
R9089:Muc16 UTSW 9 18,555,846 (GRCm39) missense unknown
R9098:Muc16 UTSW 9 18,554,975 (GRCm39) missense unknown
R9100:Muc16 UTSW 9 18,556,966 (GRCm39) missense unknown
R9128:Muc16 UTSW 9 18,558,878 (GRCm39) missense unknown
R9169:Muc16 UTSW 9 18,567,824 (GRCm39) missense unknown
R9180:Muc16 UTSW 9 18,554,038 (GRCm39) missense unknown
R9191:Muc16 UTSW 9 18,556,106 (GRCm39) missense unknown
R9203:Muc16 UTSW 9 18,462,984 (GRCm39) missense unknown
R9208:Muc16 UTSW 9 18,419,833 (GRCm39) missense probably damaging 0.99
R9232:Muc16 UTSW 9 18,567,336 (GRCm39) missense unknown
R9240:Muc16 UTSW 9 18,449,309 (GRCm39) missense unknown
R9254:Muc16 UTSW 9 18,557,467 (GRCm39) missense unknown
R9330:Muc16 UTSW 9 18,552,332 (GRCm39) missense probably benign 0.04
R9347:Muc16 UTSW 9 18,571,511 (GRCm39) missense unknown
R9358:Muc16 UTSW 9 18,553,520 (GRCm39) missense probably benign 0.01
R9359:Muc16 UTSW 9 18,449,060 (GRCm39) critical splice donor site probably null
R9379:Muc16 UTSW 9 18,557,467 (GRCm39) missense unknown
R9403:Muc16 UTSW 9 18,449,060 (GRCm39) critical splice donor site probably null
R9422:Muc16 UTSW 9 18,553,102 (GRCm39) missense probably benign 0.01
R9433:Muc16 UTSW 9 18,483,937 (GRCm39) missense probably benign 0.09
R9438:Muc16 UTSW 9 18,559,028 (GRCm39) missense unknown
R9442:Muc16 UTSW 9 18,566,624 (GRCm39) missense unknown
R9453:Muc16 UTSW 9 18,572,061 (GRCm39) missense unknown
R9467:Muc16 UTSW 9 18,508,331 (GRCm39) missense probably benign 0.03
R9490:Muc16 UTSW 9 18,568,149 (GRCm39) nonsense probably null
R9519:Muc16 UTSW 9 18,498,216 (GRCm39) missense probably benign 0.03
R9524:Muc16 UTSW 9 18,497,314 (GRCm39) missense probably benign 0.03
R9556:Muc16 UTSW 9 18,569,934 (GRCm39) missense unknown
R9583:Muc16 UTSW 9 18,549,973 (GRCm39) missense probably benign 0.01
R9600:Muc16 UTSW 9 18,567,147 (GRCm39) missense unknown
R9638:Muc16 UTSW 9 18,550,626 (GRCm39) missense probably benign 0.12
R9650:Muc16 UTSW 9 18,553,762 (GRCm39) missense unknown
R9652:Muc16 UTSW 9 18,498,178 (GRCm39) missense probably benign 0.03
R9666:Muc16 UTSW 9 18,567,285 (GRCm39) missense unknown
R9682:Muc16 UTSW 9 18,553,874 (GRCm39) missense unknown
R9765:Muc16 UTSW 9 18,548,494 (GRCm39) missense probably benign 0.16
R9766:Muc16 UTSW 9 18,552,383 (GRCm39) missense probably benign 0.01
R9766:Muc16 UTSW 9 18,548,153 (GRCm39) missense probably benign 0.08
R9776:Muc16 UTSW 9 18,570,675 (GRCm39) missense unknown
R9782:Muc16 UTSW 9 18,548,066 (GRCm39) missense possibly damaging 0.64
Z1177:Muc16 UTSW 9 18,569,157 (GRCm39) nonsense probably null
Z1177:Muc16 UTSW 9 18,448,867 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CTTCAGAAACAGTGGCCATCAC -3'
(R):5'- AGCGTGTATACTGGGAGCTG -3'

Sequencing Primer
(F):5'- TGGCCATCACTGAAGCTG -3'
(R):5'- GCTGAAAAGACTGAACATCACG -3'
Posted On 2020-09-15