Incidental Mutation 'R7922:Kmt2a'
ID 648455
Institutional Source Beutler Lab
Gene Symbol Kmt2a
Ensembl Gene ENSMUSG00000002028
Gene Name lysine (K)-specific methyltransferase 2A
Synonyms Mll1, HTRX1, ALL-1, Cxxc7, trithorax Drosophila, Mll, All1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7922 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 44803355-44881296 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 44842860 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1228 (S1228R)
Ref Sequence ENSEMBL: ENSMUSP00000110337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002095] [ENSMUST00000114689] [ENSMUST00000128768] [ENSMUST00000215489]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000002095
AA Change: S1228R
SMART Domains Protein: ENSMUSP00000002095
Gene: ENSMUSG00000002028
AA Change: S1228R

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1624 7.94e-8 SMART
BROMO 1632 1766 2.24e-10 SMART
low complexity region 1816 1850 N/A INTRINSIC
PHD 1931 1977 1.74e-4 SMART
low complexity region 1990 2001 N/A INTRINSIC
FYRN 2029 2072 2.33e-20 SMART
low complexity region 2180 2194 N/A INTRINSIC
low complexity region 2215 2227 N/A INTRINSIC
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2789 2800 N/A INTRINSIC
low complexity region 2824 2833 N/A INTRINSIC
low complexity region 2856 2878 N/A INTRINSIC
low complexity region 2902 2909 N/A INTRINSIC
low complexity region 3115 3141 N/A INTRINSIC
low complexity region 3164 3175 N/A INTRINSIC
low complexity region 3228 3239 N/A INTRINSIC
low complexity region 3299 3312 N/A INTRINSIC
low complexity region 3342 3351 N/A INTRINSIC
low complexity region 3405 3419 N/A INTRINSIC
low complexity region 3498 3526 N/A INTRINSIC
low complexity region 3620 3633 N/A INTRINSIC
FYRC 3662 3747 8.54e-37 SMART
SET 3823 3945 6.09e-45 SMART
PostSET 3947 3963 1.65e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114689
AA Change: S1228R
SMART Domains Protein: ENSMUSP00000110337
Gene: ENSMUSG00000002028
AA Change: S1228R

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1627 9.12e-8 SMART
BROMO 1635 1769 2.24e-10 SMART
low complexity region 1819 1853 N/A INTRINSIC
PHD 1934 1980 1.74e-4 SMART
low complexity region 1993 2004 N/A INTRINSIC
FYRN 2032 2075 2.33e-20 SMART
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2218 2230 N/A INTRINSIC
low complexity region 2610 2621 N/A INTRINSIC
low complexity region 2792 2803 N/A INTRINSIC
low complexity region 2827 2836 N/A INTRINSIC
low complexity region 2859 2881 N/A INTRINSIC
low complexity region 2905 2912 N/A INTRINSIC
low complexity region 3118 3144 N/A INTRINSIC
low complexity region 3167 3178 N/A INTRINSIC
low complexity region 3231 3242 N/A INTRINSIC
low complexity region 3302 3315 N/A INTRINSIC
low complexity region 3345 3354 N/A INTRINSIC
low complexity region 3408 3422 N/A INTRINSIC
low complexity region 3501 3529 N/A INTRINSIC
low complexity region 3623 3636 N/A INTRINSIC
FYRC 3665 3750 8.54e-37 SMART
SET 3826 3948 6.09e-45 SMART
PostSET 3950 3966 1.65e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000128768
AA Change: S1261R
SMART Domains Protein: ENSMUSP00000122541
Gene: ENSMUSG00000002028
AA Change: S1261R

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
SCOP:d1gkub1 59 105 6e-3 SMART
PDB:3U88|N 103 131 2e-10 PDB
low complexity region 132 142 N/A INTRINSIC
AT_hook 204 216 2.12e2 SMART
AT_hook 250 262 4.68e1 SMART
AT_hook 331 343 2.8e0 SMART
coiled coil region 399 427 N/A INTRINSIC
low complexity region 483 522 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 577 607 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
low complexity region 693 707 N/A INTRINSIC
low complexity region 750 765 N/A INTRINSIC
low complexity region 793 823 N/A INTRINSIC
low complexity region 899 925 N/A INTRINSIC
low complexity region 1022 1038 N/A INTRINSIC
Pfam:zf-CXXC 1177 1224 2.4e-16 PFAM
low complexity region 1237 1266 N/A INTRINSIC
low complexity region 1269 1316 N/A INTRINSIC
Blast:BROMO 1317 1438 3e-14 BLAST
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000215489
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional coactivator that plays an essential role in regulating gene expression during early development and hematopoiesis. The encoded protein contains multiple conserved functional domains. One of these domains, the SET domain, is responsible for its histone H3 lysine 4 (H3K4) methyltransferase activity which mediates chromatin modifications associated with epigenetic transcriptional activation. This protein is processed by the enzyme Taspase 1 into two fragments, MLL-C and MLL-N. These fragments reassociate and further assemble into different multiprotein complexes that regulate the transcription of specific target genes, including many of the HOX genes. Multiple chromosomal translocations involving this gene are the cause of certain acute lymphoid leukemias and acute myeloid leukemias. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 11.5-14.5 with edematous bodies, petechiae, and hematopoietic insufficiency. Heterozygotes show reduced growth, hematopoietic abnormalities, and homeotic transformations of the axial skeleton. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,164,406 T638M possibly damaging Het
4930546C10Rik A G 18: 68,949,996 probably null Het
Abi3 A T 11: 95,832,793 Y342N unknown Het
Adk G A 14: 21,318,043 V195I probably benign Het
Ago2 C T 15: 73,126,526 V268M possibly damaging Het
Apaf1 T C 10: 90,999,753 I1077V probably benign Het
Arap1 A T 7: 101,404,414 K1317* probably null Het
Auts2 T A 5: 131,440,373 D493V Het
Baz1b A T 5: 135,231,679 Q1110L probably damaging Het
Brsk2 T A 7: 141,993,220 S467T possibly damaging Het
Btbd9 A T 17: 30,274,884 M511K probably benign Het
Cdh23 T A 10: 60,382,706 Y1385F probably benign Het
Cfap100 A C 6: 90,403,980 L427V unknown Het
Cnga1 A G 5: 72,604,882 F430L possibly damaging Het
Dnhd1 A T 7: 105,668,514 D472V probably damaging Het
Dock2 T A 11: 34,707,327 E339V probably benign Het
Eif3a A T 19: 60,775,842 V379E probably damaging Het
Erich4 T A 7: 25,615,743 N36Y probably damaging Het
Fam60a T A 6: 148,926,146 T125S probably benign Het
Frem2 T C 3: 53,653,304 T1261A probably damaging Het
Fzd6 A T 15: 39,031,108 D223V probably damaging Het
Gabra2 A T 5: 71,007,972 Y218* probably null Het
Gcn1l1 G T 5: 115,614,468 M2177I probably benign Het
Ghr G A 15: 3,341,074 T103I possibly damaging Het
Gipc1 T C 8: 83,661,228 V79A probably benign Het
Gm10031 A T 1: 156,524,992 L254F probably damaging Het
Gm13272 T A 4: 88,780,340 V164D probably damaging Het
Gramd4 C A 15: 86,131,958 H503Q probably benign Het
Gstm4 A T 3: 108,044,671 M1K probably null Het
Heatr5b T A 17: 78,760,559 Q1800L probably benign Het
Hectd1 T A 12: 51,790,195 K826* probably null Het
Hoxa9 T C 6: 52,224,309 I251V possibly damaging Het
Il2ra A T 2: 11,674,366 I46F possibly damaging Het
Ints2 T A 11: 86,244,627 R320S probably benign Het
Iscu A T 5: 113,774,282 N46I probably damaging Het
Iscu G A 5: 113,774,349 R60Q unknown Het
Kcnk3 A T 5: 30,588,531 H72L probably damaging Het
Mbl2 T A 19: 30,239,238 L150Q probably damaging Het
Med13 A T 11: 86,271,005 F2166Y probably damaging Het
Mterf4 A C 1: 93,301,553 L246* probably null Het
Muc16 T C 9: 18,584,825 Q6690R probably benign Het
Myh10 T A 11: 68,808,893 L1722Q possibly damaging Het
Neurod2 T C 11: 98,327,628 M237V probably benign Het
Olfml1 A G 7: 107,571,149 Y81C probably damaging Het
Olfr735 A G 14: 50,346,415 V9A probably benign Het
Pcdhga7 A T 18: 37,716,173 N411I probably benign Het
Pcdhgb8 T C 18: 37,763,949 F691L probably benign Het
Pik3c2a A G 7: 116,391,282 V481A probably damaging Het
Pik3r6 A T 11: 68,533,875 R435S probably benign Het
Pkd1l1 G A 11: 8,849,013 H2250Y Het
Pkd1l1 A G 11: 8,909,857 S1034P Het
Plcd1 C A 9: 119,074,652 R400L possibly damaging Het
Ppp2r1a A G 17: 20,954,617 T58A probably benign Het
Ppp5c T C 7: 17,027,800 E5G possibly damaging Het
Pradc1 A C 6: 85,447,968 F82L probably benign Het
Prkag3 A T 1: 74,741,257 S416R probably benign Het
Rab3gap2 T C 1: 185,249,920 C390R probably benign Het
Rhot1 A G 11: 80,265,803 T655A probably benign Het
Rorc A G 3: 94,391,188 I348V probably damaging Het
Ryr1 A T 7: 29,097,224 V1051E probably benign Het
Sema5b GCAC GC 16: 35,658,256 probably null Het
Serpinb3c G A 1: 107,272,014 T259I probably damaging Het
Sh3gl1 A T 17: 56,019,438 M70K probably damaging Het
Slc7a4 C T 16: 17,573,366 V607I probably benign Het
Spop A T 11: 95,471,328 N62Y probably damaging Het
Spout1 A G 2: 30,176,811 F130S probably benign Het
Tab1 A G 15: 80,158,865 H420R possibly damaging Het
Tecpr2 CA C 12: 110,932,642 probably null Het
Tnxb G C 17: 34,714,603 K2332N probably damaging Het
Togaram1 T C 12: 64,967,738 Y588H probably damaging Het
Trim71 G A 9: 114,513,085 R710C probably damaging Het
Tsen54 C T 11: 115,820,782 Q342* probably null Het
Ube2r2 T A 4: 41,190,812 N235K unknown Het
Utrn C A 10: 12,667,527 K1792N possibly damaging Het
Vmn1r122 A G 7: 21,133,662 I156T possibly damaging Het
Vmn1r94 T C 7: 20,167,711 T223A possibly damaging Het
Vmn2r120 G A 17: 57,524,683 R369W probably damaging Het
Vwa7 G T 17: 35,024,433 A717S possibly damaging Het
Zc3h4 T A 7: 16,425,722 C398S unknown Het
Zc3hc1 T A 6: 30,390,875 E43V possibly damaging Het
Zfp101 A T 17: 33,381,537 V415D possibly damaging Het
Zfp553 A G 7: 127,236,596 H441R probably damaging Het
Other mutations in Kmt2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Kmt2a APN 9 44807934 unclassified probably benign
IGL00667:Kmt2a APN 9 44824386 utr 3 prime probably benign
IGL00828:Kmt2a APN 9 44820776 unclassified probably benign
IGL01080:Kmt2a APN 9 44809092 missense unknown
IGL01131:Kmt2a APN 9 44821170 unclassified probably benign
IGL01294:Kmt2a APN 9 44820297 unclassified probably benign
IGL01432:Kmt2a APN 9 44809096 missense unknown
IGL01646:Kmt2a APN 9 44825484 utr 3 prime probably benign
IGL01777:Kmt2a APN 9 44849005 missense probably damaging 0.99
IGL01944:Kmt2a APN 9 44849767 missense probably damaging 1.00
IGL02125:Kmt2a APN 9 44848686 missense probably damaging 1.00
IGL02207:Kmt2a APN 9 44847682 missense probably damaging 0.98
IGL02424:Kmt2a APN 9 44824635 utr 3 prime probably benign
IGL02499:Kmt2a APN 9 44830509 splice site probably benign
IGL02574:Kmt2a APN 9 44830513 splice site probably benign
IGL02711:Kmt2a APN 9 44824523 splice site probably benign
IGL02828:Kmt2a APN 9 44821947 unclassified probably benign
IGL03012:Kmt2a APN 9 44810966 unclassified probably benign
IGL03242:Kmt2a APN 9 44848392 missense probably damaging 0.99
IGL03294:Kmt2a APN 9 44820565 unclassified probably benign
IGL03326:Kmt2a APN 9 44818747 nonsense probably null
Chromas UTSW 9 44820342 unclassified probably benign
Heteros UTSW 9 44828811 nonsense probably null
Polonium UTSW 9 44814641 nonsense probably null
Pyknos UTSW 9 44826828 utr 3 prime probably benign
Skies UTSW 9 44829261 utr 3 prime probably benign
spacious UTSW 9 44847645 missense probably benign 0.03
ukrainium UTSW 9 44842700 unclassified probably benign
Uranium UTSW 9 44849857 nonsense probably null
PIT4402001:Kmt2a UTSW 9 44841062 missense unknown
R0076:Kmt2a UTSW 9 44830059 utr 3 prime probably benign
R0076:Kmt2a UTSW 9 44830059 utr 3 prime probably benign
R0180:Kmt2a UTSW 9 44826851 utr 3 prime probably benign
R0363:Kmt2a UTSW 9 44809713 critical splice donor site probably null
R0411:Kmt2a UTSW 9 44819964 unclassified probably benign
R0555:Kmt2a UTSW 9 44847571 missense probably damaging 1.00
R0587:Kmt2a UTSW 9 44847534 missense probably damaging 0.99
R0865:Kmt2a UTSW 9 44818770 unclassified probably benign
R0988:Kmt2a UTSW 9 44848549 missense probably benign 0.03
R1006:Kmt2a UTSW 9 44847696 missense probably damaging 0.99
R1108:Kmt2a UTSW 9 44849062 missense probably damaging 1.00
R1292:Kmt2a UTSW 9 44814694 utr 3 prime probably benign
R1322:Kmt2a UTSW 9 44821121 unclassified probably benign
R1476:Kmt2a UTSW 9 44824635 utr 3 prime probably benign
R1485:Kmt2a UTSW 9 44826928 utr 3 prime probably benign
R1487:Kmt2a UTSW 9 44833990 utr 3 prime probably benign
R1493:Kmt2a UTSW 9 44846905 missense probably damaging 1.00
R1499:Kmt2a UTSW 9 44848266 missense probably benign 0.36
R1507:Kmt2a UTSW 9 44818403 unclassified probably benign
R1603:Kmt2a UTSW 9 44841561 splice site probably null
R1635:Kmt2a UTSW 9 44824369 utr 3 prime probably benign
R1662:Kmt2a UTSW 9 44836670 utr 3 prime probably benign
R1711:Kmt2a UTSW 9 44841621 missense unknown
R1785:Kmt2a UTSW 9 44819675 unclassified probably benign
R1786:Kmt2a UTSW 9 44819675 unclassified probably benign
R1919:Kmt2a UTSW 9 44820345 unclassified probably benign
R1964:Kmt2a UTSW 9 44820644 missense probably benign 0.23
R1965:Kmt2a UTSW 9 44821460 unclassified probably benign
R2029:Kmt2a UTSW 9 44818450 missense probably benign 0.23
R2054:Kmt2a UTSW 9 44823374 utr 3 prime probably benign
R2259:Kmt2a UTSW 9 44881142 unclassified probably benign
R2382:Kmt2a UTSW 9 44820910 unclassified probably benign
R2483:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R3033:Kmt2a UTSW 9 44821863 unclassified probably benign
R3423:Kmt2a UTSW 9 44820097 unclassified probably benign
R3428:Kmt2a UTSW 9 44848119 missense probably benign 0.06
R3605:Kmt2a UTSW 9 44849196 missense probably damaging 1.00
R3607:Kmt2a UTSW 9 44849196 missense probably damaging 1.00
R3611:Kmt2a UTSW 9 44822466 unclassified probably benign
R3623:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R3745:Kmt2a UTSW 9 44831340 utr 3 prime probably benign
R3806:Kmt2a UTSW 9 44820356 unclassified probably benign
R3841:Kmt2a UTSW 9 44831291 utr 3 prime probably benign
R3855:Kmt2a UTSW 9 44830499 utr 3 prime probably benign
R4027:Kmt2a UTSW 9 44836693 utr 3 prime probably benign
R4124:Kmt2a UTSW 9 44819796 unclassified probably benign
R4177:Kmt2a UTSW 9 44820983 unclassified probably benign
R4296:Kmt2a UTSW 9 44821175 unclassified probably benign
R4414:Kmt2a UTSW 9 44809780 unclassified probably benign
R4461:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R4668:Kmt2a UTSW 9 44824572 utr 3 prime probably benign
R4761:Kmt2a UTSW 9 44849124 missense probably damaging 1.00
R4812:Kmt2a UTSW 9 44831354 utr 3 prime probably benign
R4815:Kmt2a UTSW 9 44821256 unclassified probably benign
R4817:Kmt2a UTSW 9 44821466 unclassified probably benign
R4888:Kmt2a UTSW 9 44821680 unclassified probably benign
R4958:Kmt2a UTSW 9 44848467 missense probably damaging 1.00
R5055:Kmt2a UTSW 9 44818352 unclassified probably benign
R5065:Kmt2a UTSW 9 44842700 unclassified probably benign
R5185:Kmt2a UTSW 9 44820246 unclassified probably benign
R5358:Kmt2a UTSW 9 44819274 unclassified probably benign
R5411:Kmt2a UTSW 9 44848485 missense probably damaging 1.00
R5420:Kmt2a UTSW 9 44848336 missense probably damaging 1.00
R5483:Kmt2a UTSW 9 44824624 utr 3 prime probably benign
R5487:Kmt2a UTSW 9 44821975 unclassified probably benign
R5488:Kmt2a UTSW 9 44841038 utr 3 prime probably benign
R5489:Kmt2a UTSW 9 44841038 utr 3 prime probably benign
R5538:Kmt2a UTSW 9 44820342 unclassified probably benign
R5576:Kmt2a UTSW 9 44842634 missense possibly damaging 0.94
R5631:Kmt2a UTSW 9 44820688 unclassified probably benign
R5781:Kmt2a UTSW 9 44847842 nonsense probably null
R5789:Kmt2a UTSW 9 44819904 unclassified probably benign
R5932:Kmt2a UTSW 9 44820647 unclassified probably benign
R6027:Kmt2a UTSW 9 44819290 unclassified probably benign
R6191:Kmt2a UTSW 9 44826828 utr 3 prime probably benign
R6239:Kmt2a UTSW 9 44819796 unclassified probably benign
R6291:Kmt2a UTSW 9 44832874 utr 3 prime probably benign
R6344:Kmt2a UTSW 9 44821859 unclassified probably benign
R6611:Kmt2a UTSW 9 44849272 missense probably damaging 0.98
R6641:Kmt2a UTSW 9 44819835 unclassified probably benign
R6651:Kmt2a UTSW 9 44828811 nonsense probably null
R6825:Kmt2a UTSW 9 44818407 unclassified probably benign
R6853:Kmt2a UTSW 9 44818407 unclassified probably benign
R6897:Kmt2a UTSW 9 44847645 missense probably benign 0.03
R6930:Kmt2a UTSW 9 44842665 unclassified probably benign
R6932:Kmt2a UTSW 9 44829261 utr 3 prime probably benign
R6957:Kmt2a UTSW 9 44820022 unclassified probably benign
R7170:Kmt2a UTSW 9 44810721 missense unknown
R7202:Kmt2a UTSW 9 44847715 missense probably benign 0.03
R7481:Kmt2a UTSW 9 44809071 missense unknown
R7538:Kmt2a UTSW 9 44847744 missense probably damaging 0.99
R7597:Kmt2a UTSW 9 44831353 missense unknown
R7741:Kmt2a UTSW 9 44808062 missense unknown
R7767:Kmt2a UTSW 9 44818998 missense unknown
R7768:Kmt2a UTSW 9 44820603 missense unknown
R7861:Kmt2a UTSW 9 44818734 missense unknown
R7894:Kmt2a UTSW 9 44849857 nonsense probably null
R7943:Kmt2a UTSW 9 44849140 missense probably damaging 0.97
R7997:Kmt2a UTSW 9 44833923 missense unknown
R8033:Kmt2a UTSW 9 44845470 missense probably damaging 1.00
R8055:Kmt2a UTSW 9 44821081 missense unknown
R8139:Kmt2a UTSW 9 44819290 unclassified probably benign
R8156:Kmt2a UTSW 9 44822389 missense unknown
R8224:Kmt2a UTSW 9 44808029 missense unknown
R8427:Kmt2a UTSW 9 44845423 missense probably damaging 1.00
R8535:Kmt2a UTSW 9 44819515 missense possibly damaging 0.91
R8693:Kmt2a UTSW 9 44810684 missense unknown
R8757:Kmt2a UTSW 9 44842913 missense unknown
R8840:Kmt2a UTSW 9 44809719 missense unknown
R8933:Kmt2a UTSW 9 44822505 unclassified probably benign
R8998:Kmt2a UTSW 9 44821877 missense unknown
R9013:Kmt2a UTSW 9 44849911 missense probably damaging 0.97
R9053:Kmt2a UTSW 9 44821419 missense unknown
R9084:Kmt2a UTSW 9 44828833 missense unknown
R9146:Kmt2a UTSW 9 44814641 nonsense probably null
R9162:Kmt2a UTSW 9 44848066 missense probably benign 0.32
R9231:Kmt2a UTSW 9 44848615 missense probably damaging 0.99
R9250:Kmt2a UTSW 9 44848386 missense possibly damaging 0.82
R9262:Kmt2a UTSW 9 44819925 missense probably benign 0.23
R9323:Kmt2a UTSW 9 44819964 unclassified probably benign
R9472:Kmt2a UTSW 9 44822156 missense unknown
R9510:Kmt2a UTSW 9 44823234 missense unknown
R9524:Kmt2a UTSW 9 44818997 missense unknown
R9662:Kmt2a UTSW 9 44820131 missense unknown
R9664:Kmt2a UTSW 9 44848805 nonsense probably null
R9691:Kmt2a UTSW 9 44820260 missense unknown
R9750:Kmt2a UTSW 9 44836202 missense unknown
X0021:Kmt2a UTSW 9 44831235 utr 3 prime probably benign
X0025:Kmt2a UTSW 9 44825392 nonsense probably null
X0026:Kmt2a UTSW 9 44820906 unclassified probably benign
X0027:Kmt2a UTSW 9 44880896 missense possibly damaging 0.85
Z1176:Kmt2a UTSW 9 44847979 missense probably damaging 1.00
Z1177:Kmt2a UTSW 9 44819121 missense unknown
Predicted Primers PCR Primer
(F):5'- AGACCTGCTTGCTGGACTTC -3'
(R):5'- CCTCAGCTTTGTGGAGACTG -3'

Sequencing Primer
(F):5'- CTGGACTTCCGGGATGCTG -3'
(R):5'- CCTCAGCTTTGTGGAGACTGAGTAC -3'
Posted On 2020-09-15