Incidental Mutation 'R7922:Utrn'
ID 648458
Institutional Source Beutler Lab
Gene Symbol Utrn
Ensembl Gene ENSMUSG00000019820
Gene Name utrophin
Synonyms G-utrophin, Dmdl, DRP
MMRRC Submission 045969-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7922 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 12257932-12745109 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 12543271 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 1792 (K1792N)
Ref Sequence ENSEMBL: ENSMUSP00000076093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000218635]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000076817
AA Change: K1792N

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820
AA Change: K1792N

DomainStartEndE-ValueType
CH 33 133 1.87e-24 SMART
CH 152 250 4.05e-20 SMART
SPEC 312 416 2.31e-18 SMART
SPEC 421 525 4.18e-16 SMART
SPEC 532 636 3.35e-6 SMART
low complexity region 665 679 N/A INTRINSIC
SPEC 690 795 1.7e-7 SMART
SPEC 801 901 1e-4 SMART
SPEC 910 1012 8.24e-2 SMART
SPEC 1019 1121 1.32e-4 SMART
SPEC 1128 1229 2.64e-4 SMART
SPEC 1236 1333 4.42e-6 SMART
coiled coil region 1375 1401 N/A INTRINSIC
SPEC 1438 1540 3.62e-2 SMART
SPEC 1547 1648 7.95e-1 SMART
SPEC 1655 1752 3.56e0 SMART
coiled coil region 1766 1795 N/A INTRINSIC
SPEC 1870 1972 3.63e0 SMART
SPEC 1979 2080 5.15e-16 SMART
SPEC 2087 2183 3.71e0 SMART
SPEC 2227 2330 4.7e-10 SMART
SPEC 2337 2437 1.02e0 SMART
SPEC 2444 2553 2.35e-10 SMART
SPEC 2560 2685 8.77e-10 SMART
SPEC 2692 2794 4.13e-6 SMART
WW 2811 2843 5.59e-7 SMART
Pfam:EF-hand_2 2844 2962 3.8e-41 PFAM
Pfam:EF-hand_3 2966 3057 1.6e-39 PFAM
ZnF_ZZ 3062 3107 6.33e-17 SMART
coiled coil region 3250 3289 N/A INTRINSIC
coiled coil region 3310 3354 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000218635
AA Change: K1792N

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,211,180 (GRCm39) T638M possibly damaging Het
4930546C10Rik A G 18: 69,083,067 (GRCm39) probably null Het
Abi3 A T 11: 95,723,619 (GRCm39) Y342N unknown Het
Adk G A 14: 21,368,111 (GRCm39) V195I probably benign Het
Ago2 C T 15: 72,998,375 (GRCm39) V268M possibly damaging Het
Apaf1 T C 10: 90,835,615 (GRCm39) I1077V probably benign Het
Arap1 A T 7: 101,053,621 (GRCm39) K1317* probably null Het
Auts2 T A 5: 131,469,211 (GRCm39) D493V Het
Baz1b A T 5: 135,260,533 (GRCm39) Q1110L probably damaging Het
Brsk2 T A 7: 141,546,957 (GRCm39) S467T possibly damaging Het
Btbd9 A T 17: 30,493,858 (GRCm39) M511K probably benign Het
Cdh23 T A 10: 60,218,485 (GRCm39) Y1385F probably benign Het
Cfap100 A C 6: 90,380,962 (GRCm39) L427V unknown Het
Cnga1 A G 5: 72,762,225 (GRCm39) F430L possibly damaging Het
Csnk2a1-ps3 A T 1: 156,352,562 (GRCm39) L254F probably damaging Het
Dnhd1 A T 7: 105,317,721 (GRCm39) D472V probably damaging Het
Dock2 T A 11: 34,598,154 (GRCm39) E339V probably benign Het
Eif3a A T 19: 60,764,280 (GRCm39) V379E probably damaging Het
Erich4 T A 7: 25,315,168 (GRCm39) N36Y probably damaging Het
Frem2 T C 3: 53,560,725 (GRCm39) T1261A probably damaging Het
Fzd6 A T 15: 38,894,503 (GRCm39) D223V probably damaging Het
Gabra2 A T 5: 71,165,315 (GRCm39) Y218* probably null Het
Gcn1 G T 5: 115,752,527 (GRCm39) M2177I probably benign Het
Ghr G A 15: 3,370,556 (GRCm39) T103I possibly damaging Het
Gipc1 T C 8: 84,387,857 (GRCm39) V79A probably benign Het
Gm13272 T A 4: 88,698,577 (GRCm39) V164D probably damaging Het
Gramd4 C A 15: 86,016,159 (GRCm39) H503Q probably benign Het
Gstm4 A T 3: 107,951,987 (GRCm39) M1K probably null Het
Heatr5b T A 17: 79,067,988 (GRCm39) Q1800L probably benign Het
Hectd1 T A 12: 51,836,978 (GRCm39) K826* probably null Het
Hoxa9 T C 6: 52,201,289 (GRCm39) I251V possibly damaging Het
Il2ra A T 2: 11,679,177 (GRCm39) I46F possibly damaging Het
Ints2 T A 11: 86,135,453 (GRCm39) R320S probably benign Het
Iscu A T 5: 113,912,343 (GRCm39) N46I probably damaging Het
Iscu G A 5: 113,912,410 (GRCm39) R60Q unknown Het
Kcnk3 A T 5: 30,745,875 (GRCm39) H72L probably damaging Het
Kmt2a T G 9: 44,754,157 (GRCm39) S1228R unknown Het
Mbl2 T A 19: 30,216,638 (GRCm39) L150Q probably damaging Het
Med13 A T 11: 86,161,831 (GRCm39) F2166Y probably damaging Het
Mterf4 A C 1: 93,229,275 (GRCm39) L246* probably null Het
Muc16 T C 9: 18,496,121 (GRCm39) Q6690R probably benign Het
Myh10 T A 11: 68,699,719 (GRCm39) L1722Q possibly damaging Het
Neurod2 T C 11: 98,218,454 (GRCm39) M237V probably benign Het
Olfml1 A G 7: 107,170,356 (GRCm39) Y81C probably damaging Het
Or4q3 A G 14: 50,583,872 (GRCm39) V9A probably benign Het
Pcdhga7 A T 18: 37,849,226 (GRCm39) N411I probably benign Het
Pcdhgb8 T C 18: 37,897,002 (GRCm39) F691L probably benign Het
Pik3c2a A G 7: 115,990,517 (GRCm39) V481A probably damaging Het
Pik3r6 A T 11: 68,424,701 (GRCm39) R435S probably benign Het
Pkd1l1 G A 11: 8,799,013 (GRCm39) H2250Y Het
Pkd1l1 A G 11: 8,859,857 (GRCm39) S1034P Het
Plcd1 C A 9: 118,903,720 (GRCm39) R400L possibly damaging Het
Ppp2r1a A G 17: 21,174,879 (GRCm39) T58A probably benign Het
Ppp5c T C 7: 16,761,725 (GRCm39) E5G possibly damaging Het
Pradc1 A C 6: 85,424,950 (GRCm39) F82L probably benign Het
Prkag3 A T 1: 74,780,416 (GRCm39) S416R probably benign Het
Rab3gap2 T C 1: 184,982,117 (GRCm39) C390R probably benign Het
Rhot1 A G 11: 80,156,629 (GRCm39) T655A probably benign Het
Rorc A G 3: 94,298,495 (GRCm39) I348V probably damaging Het
Ryr1 A T 7: 28,796,649 (GRCm39) V1051E probably benign Het
Sema5b GCAC GC 16: 35,478,626 (GRCm39) probably null Het
Serpinb3c G A 1: 107,199,744 (GRCm39) T259I probably damaging Het
Sh3gl1 A T 17: 56,326,438 (GRCm39) M70K probably damaging Het
Sinhcaf T A 6: 148,827,644 (GRCm39) T125S probably benign Het
Slc7a4 C T 16: 17,391,230 (GRCm39) V607I probably benign Het
Spop A T 11: 95,362,154 (GRCm39) N62Y probably damaging Het
Spout1 A G 2: 30,066,823 (GRCm39) F130S probably benign Het
Tab1 A G 15: 80,043,066 (GRCm39) H420R possibly damaging Het
Tecpr2 CA C 12: 110,899,076 (GRCm39) probably null Het
Tnxb G C 17: 34,933,577 (GRCm39) K2332N probably damaging Het
Togaram1 T C 12: 65,014,512 (GRCm39) Y588H probably damaging Het
Trim71 G A 9: 114,342,153 (GRCm39) R710C probably damaging Het
Tsen54 C T 11: 115,711,608 (GRCm39) Q342* probably null Het
Ube2r2 T A 4: 41,190,812 (GRCm39) N235K unknown Het
Vmn1r122 A G 7: 20,867,587 (GRCm39) I156T possibly damaging Het
Vmn1r94 T C 7: 19,901,636 (GRCm39) T223A possibly damaging Het
Vmn2r120 G A 17: 57,831,683 (GRCm39) R369W probably damaging Het
Vwa7 G T 17: 35,243,409 (GRCm39) A717S possibly damaging Het
Zc3h4 T A 7: 16,159,647 (GRCm39) C398S unknown Het
Zc3hc1 T A 6: 30,390,874 (GRCm39) E43V possibly damaging Het
Zfp101 A T 17: 33,600,511 (GRCm39) V415D possibly damaging Het
Zfp553 A G 7: 126,835,768 (GRCm39) H441R probably damaging Het
Other mutations in Utrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Utrn APN 10 12,547,574 (GRCm39) missense probably damaging 1.00
IGL00469:Utrn APN 10 12,282,273 (GRCm39) missense probably damaging 1.00
IGL00518:Utrn APN 10 12,542,587 (GRCm39) splice site probably benign
IGL00560:Utrn APN 10 12,331,211 (GRCm39) nonsense probably null
IGL00589:Utrn APN 10 12,554,362 (GRCm39) missense possibly damaging 0.53
IGL00662:Utrn APN 10 12,540,705 (GRCm39) missense probably damaging 0.99
IGL00754:Utrn APN 10 12,539,236 (GRCm39) missense probably benign 0.05
IGL00772:Utrn APN 10 12,524,929 (GRCm39) missense probably benign
IGL00775:Utrn APN 10 12,620,974 (GRCm39) critical splice donor site probably null
IGL00782:Utrn APN 10 12,528,555 (GRCm39) missense probably benign 0.13
IGL00962:Utrn APN 10 12,357,078 (GRCm39) missense possibly damaging 0.80
IGL01584:Utrn APN 10 12,602,111 (GRCm39) missense probably benign 0.01
IGL01677:Utrn APN 10 12,619,901 (GRCm39) missense probably damaging 1.00
IGL01695:Utrn APN 10 12,621,086 (GRCm39) missense probably benign 0.00
IGL01743:Utrn APN 10 12,587,301 (GRCm39) missense possibly damaging 0.94
IGL01815:Utrn APN 10 12,528,460 (GRCm39) missense probably benign 0.00
IGL01901:Utrn APN 10 12,516,672 (GRCm39) missense probably damaging 1.00
IGL01982:Utrn APN 10 12,623,773 (GRCm39) missense probably damaging 1.00
IGL01983:Utrn APN 10 12,545,525 (GRCm39) missense probably benign 0.18
IGL02031:Utrn APN 10 12,610,948 (GRCm39) missense probably damaging 1.00
IGL02106:Utrn APN 10 12,289,717 (GRCm39) missense possibly damaging 0.92
IGL02134:Utrn APN 10 12,519,163 (GRCm39) missense probably damaging 0.99
IGL02209:Utrn APN 10 12,559,039 (GRCm39) missense probably damaging 0.97
IGL02217:Utrn APN 10 12,627,303 (GRCm39) missense probably damaging 1.00
IGL02250:Utrn APN 10 12,312,135 (GRCm39) missense probably damaging 1.00
IGL02307:Utrn APN 10 12,625,809 (GRCm39) nonsense probably null
IGL02386:Utrn APN 10 12,297,352 (GRCm39) missense possibly damaging 0.91
IGL02494:Utrn APN 10 12,585,798 (GRCm39) missense probably benign
IGL02631:Utrn APN 10 12,585,807 (GRCm39) missense probably benign 0.00
IGL02729:Utrn APN 10 12,596,554 (GRCm39) unclassified probably benign
IGL02736:Utrn APN 10 12,297,384 (GRCm39) missense probably damaging 1.00
IGL02832:Utrn APN 10 12,613,937 (GRCm39) missense possibly damaging 0.82
IGL02926:Utrn APN 10 12,566,504 (GRCm39) missense probably damaging 0.96
IGL03184:Utrn APN 10 12,585,910 (GRCm39) missense probably benign 0.04
IGL03194:Utrn APN 10 12,282,173 (GRCm39) splice site probably benign
IGL03346:Utrn APN 10 12,401,096 (GRCm39) missense probably benign 0.22
retiring UTSW 10 12,516,764 (GRCm39) missense probably damaging 1.00
shrinking_violet UTSW 10 12,587,329 (GRCm39) critical splice acceptor site probably null
Wallflower UTSW 10 12,623,719 (GRCm39) missense probably damaging 1.00
FR4548:Utrn UTSW 10 12,509,685 (GRCm39) critical splice donor site probably benign
I2288:Utrn UTSW 10 12,297,384 (GRCm39) missense probably damaging 1.00
PIT4677001:Utrn UTSW 10 12,542,448 (GRCm39) missense probably benign 0.06
R0022:Utrn UTSW 10 12,585,700 (GRCm39) splice site probably benign
R0024:Utrn UTSW 10 12,281,755 (GRCm39) missense probably benign 0.00
R0024:Utrn UTSW 10 12,281,755 (GRCm39) missense probably benign 0.00
R0026:Utrn UTSW 10 12,601,940 (GRCm39) splice site probably benign
R0026:Utrn UTSW 10 12,601,940 (GRCm39) splice site probably benign
R0091:Utrn UTSW 10 12,610,948 (GRCm39) missense probably damaging 1.00
R0112:Utrn UTSW 10 12,562,209 (GRCm39) nonsense probably null
R0126:Utrn UTSW 10 12,587,219 (GRCm39) missense probably benign 0.02
R0184:Utrn UTSW 10 12,543,362 (GRCm39) missense probably benign
R0219:Utrn UTSW 10 12,560,195 (GRCm39) missense probably damaging 1.00
R0369:Utrn UTSW 10 12,509,766 (GRCm39) missense probably benign 0.37
R0390:Utrn UTSW 10 12,585,804 (GRCm39) missense probably benign 0.05
R0391:Utrn UTSW 10 12,401,077 (GRCm39) splice site probably benign
R0408:Utrn UTSW 10 12,259,934 (GRCm39) makesense probably null
R0409:Utrn UTSW 10 12,519,345 (GRCm39) missense probably benign 0.01
R0441:Utrn UTSW 10 12,564,038 (GRCm39) missense probably null 0.88
R0504:Utrn UTSW 10 12,278,639 (GRCm39) missense probably benign 0.02
R0730:Utrn UTSW 10 12,573,902 (GRCm39) splice site probably benign
R1078:Utrn UTSW 10 12,331,310 (GRCm39) critical splice acceptor site probably null
R1171:Utrn UTSW 10 12,357,052 (GRCm39) missense probably damaging 0.99
R1191:Utrn UTSW 10 12,509,777 (GRCm39) missense probably benign 0.02
R1203:Utrn UTSW 10 12,362,281 (GRCm39) missense probably damaging 1.00
R1401:Utrn UTSW 10 12,524,897 (GRCm39) missense probably benign
R1418:Utrn UTSW 10 12,589,094 (GRCm39) missense probably benign
R1439:Utrn UTSW 10 12,619,793 (GRCm39) missense possibly damaging 0.79
R1441:Utrn UTSW 10 12,559,039 (GRCm39) missense probably damaging 0.97
R1445:Utrn UTSW 10 12,554,318 (GRCm39) splice site probably benign
R1509:Utrn UTSW 10 12,331,185 (GRCm39) missense possibly damaging 0.91
R1546:Utrn UTSW 10 12,312,108 (GRCm39) missense probably damaging 1.00
R1585:Utrn UTSW 10 12,312,029 (GRCm39) missense possibly damaging 0.62
R1621:Utrn UTSW 10 12,589,027 (GRCm39) missense probably benign 0.24
R1637:Utrn UTSW 10 12,312,108 (GRCm39) missense probably damaging 1.00
R1703:Utrn UTSW 10 12,603,473 (GRCm39) splice site probably benign
R1725:Utrn UTSW 10 12,539,263 (GRCm39) missense probably damaging 0.99
R1735:Utrn UTSW 10 12,585,882 (GRCm39) missense probably benign
R1770:Utrn UTSW 10 12,351,040 (GRCm39) missense probably damaging 0.98
R1778:Utrn UTSW 10 12,312,108 (GRCm39) missense probably damaging 1.00
R1783:Utrn UTSW 10 12,339,083 (GRCm39) missense probably damaging 1.00
R1818:Utrn UTSW 10 12,585,708 (GRCm39) critical splice donor site probably null
R1829:Utrn UTSW 10 12,351,018 (GRCm39) missense probably damaging 1.00
R1919:Utrn UTSW 10 12,331,224 (GRCm39) missense probably benign 0.15
R1964:Utrn UTSW 10 12,560,181 (GRCm39) missense probably damaging 1.00
R2080:Utrn UTSW 10 12,612,826 (GRCm39) missense probably benign 0.36
R2092:Utrn UTSW 10 12,554,442 (GRCm39) missense probably benign 0.12
R2107:Utrn UTSW 10 12,312,108 (GRCm39) missense probably damaging 1.00
R2108:Utrn UTSW 10 12,312,108 (GRCm39) missense probably damaging 1.00
R2760:Utrn UTSW 10 12,566,622 (GRCm39) missense probably damaging 1.00
R2884:Utrn UTSW 10 12,615,105 (GRCm39) splice site probably null
R2885:Utrn UTSW 10 12,615,105 (GRCm39) splice site probably null
R2886:Utrn UTSW 10 12,615,105 (GRCm39) splice site probably null
R2903:Utrn UTSW 10 12,519,172 (GRCm39) missense probably damaging 1.00
R2944:Utrn UTSW 10 12,519,163 (GRCm39) missense probably damaging 1.00
R2945:Utrn UTSW 10 12,362,135 (GRCm39) missense possibly damaging 0.50
R3438:Utrn UTSW 10 12,357,062 (GRCm39) missense probably damaging 0.98
R3683:Utrn UTSW 10 12,542,579 (GRCm39) missense probably benign 0.10
R3735:Utrn UTSW 10 12,354,228 (GRCm39) missense probably damaging 1.00
R3907:Utrn UTSW 10 12,585,926 (GRCm39) splice site probably benign
R3923:Utrn UTSW 10 12,615,223 (GRCm39) missense probably benign 0.23
R3925:Utrn UTSW 10 12,573,786 (GRCm39) missense probably benign
R3926:Utrn UTSW 10 12,573,786 (GRCm39) missense probably benign
R3938:Utrn UTSW 10 12,625,774 (GRCm39) critical splice donor site probably null
R3941:Utrn UTSW 10 12,587,329 (GRCm39) critical splice acceptor site probably null
R3958:Utrn UTSW 10 12,625,852 (GRCm39) missense probably damaging 1.00
R4091:Utrn UTSW 10 12,585,915 (GRCm39) missense probably benign 0.10
R4454:Utrn UTSW 10 12,603,584 (GRCm39) missense possibly damaging 0.81
R4585:Utrn UTSW 10 12,564,050 (GRCm39) missense probably benign 0.01
R4667:Utrn UTSW 10 12,573,797 (GRCm39) missense probably benign 0.22
R4684:Utrn UTSW 10 12,620,984 (GRCm39) missense probably damaging 1.00
R4782:Utrn UTSW 10 12,625,813 (GRCm39) missense probably damaging 1.00
R4785:Utrn UTSW 10 12,530,489 (GRCm39) missense probably benign 0.39
R4799:Utrn UTSW 10 12,625,813 (GRCm39) missense probably damaging 1.00
R4829:Utrn UTSW 10 12,539,205 (GRCm39) missense probably benign 0.00
R4878:Utrn UTSW 10 12,603,502 (GRCm39) missense probably damaging 1.00
R4955:Utrn UTSW 10 12,737,311 (GRCm39) critical splice donor site probably null
R4967:Utrn UTSW 10 12,331,164 (GRCm39) missense probably damaging 0.99
R5071:Utrn UTSW 10 12,259,948 (GRCm39) splice site probably null
R5072:Utrn UTSW 10 12,259,948 (GRCm39) splice site probably null
R5186:Utrn UTSW 10 12,604,521 (GRCm39) missense probably damaging 1.00
R5213:Utrn UTSW 10 12,512,504 (GRCm39) missense probably damaging 1.00
R5296:Utrn UTSW 10 12,277,099 (GRCm39) missense probably damaging 1.00
R5309:Utrn UTSW 10 12,603,513 (GRCm39) missense probably damaging 1.00
R5312:Utrn UTSW 10 12,603,513 (GRCm39) missense probably damaging 1.00
R5399:Utrn UTSW 10 12,516,727 (GRCm39) missense probably damaging 1.00
R5407:Utrn UTSW 10 12,556,369 (GRCm39) missense probably damaging 1.00
R5411:Utrn UTSW 10 12,524,929 (GRCm39) missense probably benign
R5428:Utrn UTSW 10 12,569,175 (GRCm39) missense probably benign 0.09
R5595:Utrn UTSW 10 12,558,062 (GRCm39) missense possibly damaging 0.89
R5602:Utrn UTSW 10 12,625,839 (GRCm39) missense probably damaging 1.00
R5608:Utrn UTSW 10 12,547,581 (GRCm39) missense probably benign 0.00
R5678:Utrn UTSW 10 12,317,762 (GRCm39) missense probably damaging 1.00
R5726:Utrn UTSW 10 12,545,550 (GRCm39) missense probably benign
R5804:Utrn UTSW 10 12,297,369 (GRCm39) missense probably damaging 1.00
R5916:Utrn UTSW 10 12,540,795 (GRCm39) missense probably damaging 0.97
R5941:Utrn UTSW 10 12,362,227 (GRCm39) missense probably damaging 1.00
R6014:Utrn UTSW 10 12,566,620 (GRCm39) missense probably benign 0.01
R6015:Utrn UTSW 10 12,354,168 (GRCm39) missense possibly damaging 0.85
R6028:Utrn UTSW 10 12,530,460 (GRCm39) missense probably benign 0.00
R6158:Utrn UTSW 10 12,566,566 (GRCm39) missense probably benign 0.04
R6181:Utrn UTSW 10 12,615,200 (GRCm39) missense probably damaging 1.00
R6300:Utrn UTSW 10 12,377,220 (GRCm39) missense probably benign 0.35
R6367:Utrn UTSW 10 12,623,719 (GRCm39) missense probably damaging 1.00
R6377:Utrn UTSW 10 12,619,827 (GRCm39) missense probably damaging 1.00
R6434:Utrn UTSW 10 12,401,171 (GRCm39) missense probably damaging 1.00
R6498:Utrn UTSW 10 12,317,837 (GRCm39) missense probably benign
R6579:Utrn UTSW 10 12,623,750 (GRCm39) missense probably benign 0.05
R6704:Utrn UTSW 10 12,621,035 (GRCm39) missense probably damaging 0.99
R6736:Utrn UTSW 10 12,497,047 (GRCm39) missense probably benign 0.09
R6755:Utrn UTSW 10 12,574,831 (GRCm39) missense probably benign 0.00
R6793:Utrn UTSW 10 12,574,844 (GRCm39) missense possibly damaging 0.69
R6793:Utrn UTSW 10 12,516,669 (GRCm39) critical splice donor site probably null
R6835:Utrn UTSW 10 12,603,508 (GRCm39) missense probably damaging 1.00
R6919:Utrn UTSW 10 12,569,214 (GRCm39) nonsense probably null
R6920:Utrn UTSW 10 12,626,214 (GRCm39) missense probably damaging 0.98
R7037:Utrn UTSW 10 12,702,514 (GRCm39) splice site probably null
R7038:Utrn UTSW 10 12,558,082 (GRCm39) missense probably damaging 1.00
R7055:Utrn UTSW 10 12,623,665 (GRCm39) missense probably benign 0.23
R7072:Utrn UTSW 10 12,340,957 (GRCm39) missense probably damaging 1.00
R7090:Utrn UTSW 10 12,560,260 (GRCm39) missense possibly damaging 0.58
R7211:Utrn UTSW 10 12,277,079 (GRCm39) missense possibly damaging 0.72
R7248:Utrn UTSW 10 12,604,562 (GRCm39) missense possibly damaging 0.51
R7305:Utrn UTSW 10 12,261,280 (GRCm39) missense probably benign
R7334:Utrn UTSW 10 12,603,753 (GRCm39) splice site probably null
R7348:Utrn UTSW 10 12,623,762 (GRCm39) missense probably damaging 1.00
R7375:Utrn UTSW 10 12,516,764 (GRCm39) missense probably damaging 1.00
R7436:Utrn UTSW 10 12,315,535 (GRCm39) missense possibly damaging 0.72
R7476:Utrn UTSW 10 12,516,695 (GRCm39) missense probably benign
R7514:Utrn UTSW 10 12,573,833 (GRCm39) missense probably benign 0.00
R7527:Utrn UTSW 10 12,277,126 (GRCm39) missense possibly damaging 0.81
R7735:Utrn UTSW 10 12,619,787 (GRCm39) critical splice donor site probably null
R7748:Utrn UTSW 10 12,490,252 (GRCm39) missense probably benign 0.01
R7778:Utrn UTSW 10 12,362,354 (GRCm39) missense probably damaging 1.00
R7824:Utrn UTSW 10 12,362,354 (GRCm39) missense probably damaging 1.00
R7826:Utrn UTSW 10 12,277,050 (GRCm39) splice site probably null
R7872:Utrn UTSW 10 12,573,873 (GRCm39) missense probably benign
R7915:Utrn UTSW 10 12,340,956 (GRCm39) missense probably damaging 1.00
R8081:Utrn UTSW 10 12,423,803 (GRCm39) start gained probably benign
R8132:Utrn UTSW 10 12,558,154 (GRCm39) missense probably damaging 0.99
R8167:Utrn UTSW 10 12,547,558 (GRCm39) nonsense probably null
R8186:Utrn UTSW 10 12,573,867 (GRCm39) missense probably benign
R8331:Utrn UTSW 10 12,490,363 (GRCm39) missense probably benign 0.00
R8352:Utrn UTSW 10 12,689,253 (GRCm39) missense probably benign 0.34
R8408:Utrn UTSW 10 12,545,887 (GRCm39) missense possibly damaging 0.69
R8452:Utrn UTSW 10 12,689,253 (GRCm39) missense probably benign 0.34
R8478:Utrn UTSW 10 12,524,892 (GRCm39) missense probably benign
R8489:Utrn UTSW 10 12,587,190 (GRCm39) missense probably benign 0.05
R8516:Utrn UTSW 10 12,362,254 (GRCm39) missense probably damaging 0.99
R8520:Utrn UTSW 10 12,545,930 (GRCm39) nonsense probably null
R8550:Utrn UTSW 10 12,689,329 (GRCm39) intron probably benign
R8856:Utrn UTSW 10 12,543,351 (GRCm39) missense probably benign
R8881:Utrn UTSW 10 12,423,737 (GRCm39) missense possibly damaging 0.46
R9180:Utrn UTSW 10 12,545,463 (GRCm39) missense probably damaging 1.00
R9186:Utrn UTSW 10 12,490,318 (GRCm39) missense probably benign
R9216:Utrn UTSW 10 12,689,229 (GRCm39) missense probably benign 0.19
R9251:Utrn UTSW 10 12,512,531 (GRCm39) missense probably benign 0.01
R9273:Utrn UTSW 10 12,509,707 (GRCm39) missense probably damaging 0.97
R9307:Utrn UTSW 10 12,554,475 (GRCm39) missense probably benign 0.02
R9344:Utrn UTSW 10 12,560,275 (GRCm39) missense probably benign 0.17
R9419:Utrn UTSW 10 12,564,125 (GRCm39) missense probably damaging 1.00
R9435:Utrn UTSW 10 12,519,173 (GRCm39) missense probably damaging 1.00
R9623:Utrn UTSW 10 12,282,225 (GRCm39) missense probably damaging 1.00
R9650:Utrn UTSW 10 12,613,929 (GRCm39) missense probably benign 0.00
R9653:Utrn UTSW 10 12,539,189 (GRCm39) missense probably benign 0.41
R9653:Utrn UTSW 10 12,497,123 (GRCm39) missense probably benign 0.17
R9672:Utrn UTSW 10 12,603,613 (GRCm39) missense possibly damaging 0.68
R9678:Utrn UTSW 10 12,615,159 (GRCm39) missense probably benign 0.00
R9741:Utrn UTSW 10 12,702,564 (GRCm39) missense probably benign
R9765:Utrn UTSW 10 12,610,921 (GRCm39) missense probably damaging 0.99
R9799:Utrn UTSW 10 12,585,736 (GRCm39) missense probably benign 0.01
RF009:Utrn UTSW 10 12,509,689 (GRCm39) nonsense probably null
V1662:Utrn UTSW 10 12,297,384 (GRCm39) missense probably damaging 1.00
X0018:Utrn UTSW 10 12,610,942 (GRCm39) missense probably damaging 1.00
Z1176:Utrn UTSW 10 12,564,173 (GRCm39) critical splice acceptor site probably null
Z1176:Utrn UTSW 10 12,558,104 (GRCm39) nonsense probably null
Z1177:Utrn UTSW 10 12,497,123 (GRCm39) missense probably benign 0.17
Z1177:Utrn UTSW 10 12,401,150 (GRCm39) nonsense probably null
Z1186:Utrn UTSW 10 12,545,491 (GRCm39) missense probably damaging 1.00
Z1189:Utrn UTSW 10 12,545,491 (GRCm39) missense probably damaging 1.00
Z1191:Utrn UTSW 10 12,545,491 (GRCm39) missense probably damaging 1.00
Z1192:Utrn UTSW 10 12,545,491 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACTTCAAGCATTGCATGAG -3'
(R):5'- AAATGCTGGTTTCTGCTGTGAC -3'

Sequencing Primer
(F):5'- TGCATGAGTTACCTGACAGC -3'
(R):5'- GCCTCTCGGGATGATTTTAGAAAATC -3'
Posted On 2020-09-15