Mutagenetix > Incidental Mutations

Incidental Mutation 'R7922:Pkd1l1'

648461

Institutional Source

Beutler Lab

Gene Symbol

Pkd1l1

Ensembl Gene

ENSMUSG00000046634

Gene Name

polycystic kidney disease 1 like 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7922 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

8826708-8973266 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 8849013 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 2250 (H2250Y)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000178195]

Predicted Effect

SMART Domains

Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: H2250Y

Domain	Start	End	E-Value	Type
low complexity region	172	184	N/A	INTRINSIC
PKD	205	287	2.9e0	SMART
PKD	291	369	1.42e-9	SMART
Pfam:REJ	398	1001	1.7e-45	PFAM
low complexity region	1208	1218	N/A	INTRINSIC
GPS	1370	1413	1.21e-1	SMART
transmembrane domain	1434	1451	N/A	INTRINSIC
LH2	1479	1598	2.94e-3	SMART
transmembrane domain	1640	1659	N/A	INTRINSIC
transmembrane domain	1679	1701	N/A	INTRINSIC
transmembrane domain	1817	1839	N/A	INTRINSIC
transmembrane domain	1854	1876	N/A	INTRINSIC
Pfam:PKD_channel	2109	2339	1.5e-23	PFAM
transmembrane domain	2381	2403	N/A	INTRINSIC
low complexity region	2436	2449	N/A	INTRINSIC
low complexity region	2458	2469	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178195
AA Change: H1800Y

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634
AA Change: H1800Y

Domain	Start	End	E-Value	Type
Pfam:REJ	3	552	3.3e-41	PFAM
low complexity region	757	767	N/A	INTRINSIC
Blast:GPS	919	965	2e-13	BLAST
transmembrane domain	983	1000	N/A	INTRINSIC
Pfam:PLAT	1030	1145	7.2e-14	PFAM
transmembrane domain	1189	1208	N/A	INTRINSIC
transmembrane domain	1228	1250	N/A	INTRINSIC
transmembrane domain	1366	1388	N/A	INTRINSIC
transmembrane domain	1403	1425	N/A	INTRINSIC
Pfam:PKD_channel	1658	1889	2e-25	PFAM
transmembrane domain	1930	1952	N/A	INTRINSIC
low complexity region	1985	1998	N/A	INTRINSIC
low complexity region	2007	2018	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	C	T	12: 71,164,406	T638M	possibly damaging	Het
4930546C10Rik	A	G	18: 68,949,996		probably null	Het
Abi3	A	T	11: 95,832,793	Y342N	unknown	Het
Adk	G	A	14: 21,318,043	V195I	probably benign	Het
Ago2	C	T	15: 73,126,526	V268M	possibly damaging	Het
Apaf1	T	C	10: 90,999,753	I1077V	probably benign	Het
Arap1	A	T	7: 101,404,414	K1317*	probably null	Het
Auts2	T	A	5: 131,440,373	D493V		Het
Baz1b	A	T	5: 135,231,679	Q1110L	probably damaging	Het
Brsk2	T	A	7: 141,993,220	S467T	possibly damaging	Het
Btbd9	A	T	17: 30,274,884	M511K	probably benign	Het
Cdh23	T	A	10: 60,382,706	Y1385F	probably benign	Het
Cfap100	A	C	6: 90,403,980	L427V	unknown	Het
Cnga1	A	G	5: 72,604,882	F430L	possibly damaging	Het
Dnhd1	A	T	7: 105,668,514	D472V	probably damaging	Het
Dock2	T	A	11: 34,707,327	E339V	probably benign	Het
Eif3a	A	T	19: 60,775,842	V379E	probably damaging	Het
Erich4	T	A	7: 25,615,743	N36Y	probably damaging	Het
Fam60a	T	A	6: 148,926,146	T125S	probably benign	Het
Frem2	T	C	3: 53,653,304	T1261A	probably damaging	Het
Fzd6	A	T	15: 39,031,108	D223V	probably damaging	Het
Gabra2	A	T	5: 71,007,972	Y218*	probably null	Het
Gcn1l1	G	T	5: 115,614,468	M2177I	probably benign	Het
Ghr	G	A	15: 3,341,074	T103I	possibly damaging	Het
Gipc1	T	C	8: 83,661,228	V79A	probably benign	Het
Gm10031	A	T	1: 156,524,992	L254F	probably damaging	Het
Gm13272	T	A	4: 88,780,340	V164D	probably damaging	Het
Gramd4	C	A	15: 86,131,958	H503Q	probably benign	Het
Gstm4	A	T	3: 108,044,671	M1K	probably null	Het
Heatr5b	T	A	17: 78,760,559	Q1800L	probably benign	Het
Hectd1	T	A	12: 51,790,195	K826*	probably null	Het
Hoxa9	T	C	6: 52,224,309	I251V	possibly damaging	Het
Il2ra	A	T	2: 11,674,366	I46F	possibly damaging	Het
Ints2	T	A	11: 86,244,627	R320S	probably benign	Het
Iscu	A	T	5: 113,774,282	N46I	probably damaging	Het
Iscu	G	A	5: 113,774,349	R60Q	unknown	Het
Kcnk3	A	T	5: 30,588,531	H72L	probably damaging	Het
Kmt2a	T	G	9: 44,842,860	S1228R	unknown	Het
Mbl2	T	A	19: 30,239,238	L150Q	probably damaging	Het
Med13	A	T	11: 86,271,005	F2166Y	probably damaging	Het
Mterf4	A	C	1: 93,301,553	L246*	probably null	Het
Muc16	T	C	9: 18,584,825	Q6690R	probably benign	Het
Myh10	T	A	11: 68,808,893	L1722Q	possibly damaging	Het
Neurod2	T	C	11: 98,327,628	M237V	probably benign	Het
Olfml1	A	G	7: 107,571,149	Y81C	probably damaging	Het
Olfr735	A	G	14: 50,346,415	V9A	probably benign	Het
Pcdhga7	A	T	18: 37,716,173	N411I	probably benign	Het
Pcdhgb8	T	C	18: 37,763,949	F691L	probably benign	Het
Pik3c2a	A	G	7: 116,391,282	V481A	probably damaging	Het
Pik3r6	A	T	11: 68,533,875	R435S	probably benign	Het
Plcd1	C	A	9: 119,074,652	R400L	possibly damaging	Het
Ppp2r1a	A	G	17: 20,954,617	T58A	probably benign	Het
Ppp5c	T	C	7: 17,027,800	E5G	possibly damaging	Het
Pradc1	A	C	6: 85,447,968	F82L	probably benign	Het
Prkag3	A	T	1: 74,741,257	S416R	probably benign	Het
Rab3gap2	T	C	1: 185,249,920	C390R	probably benign	Het
Rhot1	A	G	11: 80,265,803	T655A	probably benign	Het
Rorc	A	G	3: 94,391,188	I348V	probably damaging	Het
Ryr1	A	T	7: 29,097,224	V1051E	probably benign	Het
Sema5b	GCAC	GC	16: 35,658,256		probably null	Het
Serpinb3c	G	A	1: 107,272,014	T259I	probably damaging	Het
Sh3gl1	A	T	17: 56,019,438	M70K	probably damaging	Het
Slc7a4	C	T	16: 17,573,366	V607I	probably benign	Het
Spop	A	T	11: 95,471,328	N62Y	probably damaging	Het
Spout1	A	G	2: 30,176,811	F130S	probably benign	Het
Tab1	A	G	15: 80,158,865	H420R	possibly damaging	Het
Tecpr2	CA	C	12: 110,932,642		probably null	Het
Tnxb	G	C	17: 34,714,603	K2332N	probably damaging	Het
Togaram1	T	C	12: 64,967,738	Y588H	probably damaging	Het
Trim71	G	A	9: 114,513,085	R710C	probably damaging	Het
Tsen54	C	T	11: 115,820,782	Q342*	probably null	Het
Ube2r2	T	A	4: 41,190,812	N235K	unknown	Het
Utrn	C	A	10: 12,667,527	K1792N	possibly damaging	Het
Vmn1r122	A	G	7: 21,133,662	I156T	possibly damaging	Het
Vmn1r94	T	C	7: 20,167,711	T223A	possibly damaging	Het
Vmn2r120	G	A	17: 57,524,683	R369W	probably damaging	Het
Vwa7	G	T	17: 35,024,433	A717S	possibly damaging	Het
Zc3h4	T	A	7: 16,425,722	C398S	unknown	Het
Zc3hc1	T	A	6: 30,390,875	E43V	possibly damaging	Het
Zfp101	A	T	17: 33,381,537	V415D	possibly damaging	Het
Zfp553	A	G	7: 127,236,596	H441R	probably damaging	Het

Other mutations in Pkd1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Pkd1l1	APN	11	8961971	missense	unknown
IGL00156:Pkd1l1	APN	11	8950515	missense	probably damaging	1.00
IGL00161:Pkd1l1	APN	11	8929353	critical splice donor site	probably null
IGL00489:Pkd1l1	APN	11	8834773	critical splice donor site	probably null
IGL00495:Pkd1l1	APN	11	8868493	missense	probably benign	0.34
IGL00983:Pkd1l1	APN	11	8844585	missense	probably benign
IGL01071:Pkd1l1	APN	11	8848921	missense	probably benign	0.00
IGL01093:Pkd1l1	APN	11	8901345	missense	probably benign	0.06
IGL01295:Pkd1l1	APN	11	8933685	missense	possibly damaging	0.93
IGL01311:Pkd1l1	APN	11	8901174	missense	possibly damaging	0.53
IGL01412:Pkd1l1	APN	11	8950409	missense	possibly damaging	0.73
IGL01978:Pkd1l1	APN	11	8961336	missense	unknown
IGL01999:Pkd1l1	APN	11	8836291	missense	probably benign
IGL02080:Pkd1l1	APN	11	8961345	missense	unknown
IGL02106:Pkd1l1	APN	11	8833800	missense	probably damaging	1.00
IGL02216:Pkd1l1	APN	11	8834897	missense	probably damaging	0.96
IGL02305:Pkd1l1	APN	11	8902467	missense	probably benign
IGL02337:Pkd1l1	APN	11	8942079	missense	probably damaging	1.00
IGL02576:Pkd1l1	APN	11	8844560	missense	possibly damaging	0.61
IGL02704:Pkd1l1	APN	11	8834910	missense	probably benign	0.00
IGL02814:Pkd1l1	APN	11	8902582	missense	probably benign	0.01
IGL02904:Pkd1l1	APN	11	8868450	splice site	probably benign
IGL02972:Pkd1l1	APN	11	8863908	missense	probably damaging	0.99
IGL03091:Pkd1l1	APN	11	8855564	missense	probably damaging	1.00
IGL03113:Pkd1l1	APN	11	8834793	missense	probably benign	0.20
IGL03210:Pkd1l1	APN	11	8965127	missense	unknown
PIT4581001:Pkd1l1	UTSW	11	8916298	frame shift	probably null
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0496:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
R0547:Pkd1l1	UTSW	11	8836448	splice site	probably benign
R0582:Pkd1l1	UTSW	11	8931699	splice site	probably benign
R0761:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R0969:Pkd1l1	UTSW	11	8936898	missense	probably damaging	1.00
R1348:Pkd1l1	UTSW	11	8834806	missense	probably benign	0.18
R1366:Pkd1l1	UTSW	11	8941038	splice site	probably benign
R1401:Pkd1l1	UTSW	11	8854487	nonsense	probably null
R1444:Pkd1l1	UTSW	11	8854386	missense	probably damaging	1.00
R1445:Pkd1l1	UTSW	11	8870313	missense	probably benign	0.00
R1463:Pkd1l1	UTSW	11	8916302	missense	probably damaging	1.00
R1496:Pkd1l1	UTSW	11	8941077	missense	possibly damaging	0.95
R1542:Pkd1l1	UTSW	11	8874179	missense	possibly damaging	0.82
R1543:Pkd1l1	UTSW	11	8901200	missense	probably damaging	1.00
R1619:Pkd1l1	UTSW	11	8950413	missense	probably damaging	0.98
R1875:Pkd1l1	UTSW	11	8844670	splice site	probably benign
R1929:Pkd1l1	UTSW	11	8836197	splice site	probably benign
R1958:Pkd1l1	UTSW	11	8874161	missense	probably benign	0.01
R2223:Pkd1l1	UTSW	11	8889063	missense	probably benign	0.18
R2223:Pkd1l1	UTSW	11	8950422	missense	probably benign
R2264:Pkd1l1	UTSW	11	8879112	missense	probably damaging	0.97
R2349:Pkd1l1	UTSW	11	8826819	splice site	probably null
R2431:Pkd1l1	UTSW	11	8947197	missense	probably damaging	0.99
R2483:Pkd1l1	UTSW	11	8962701	missense	probably damaging	1.00
R2517:Pkd1l1	UTSW	11	8958900	missense	unknown
R2888:Pkd1l1	UTSW	11	8947251	missense	probably damaging	1.00
R2965:Pkd1l1	UTSW	11	8874236	missense	probably damaging	1.00
R3123:Pkd1l1	UTSW	11	8973021	missense	unknown
R3153:Pkd1l1	UTSW	11	8867207	missense	probably benign	0.01
R3840:Pkd1l1	UTSW	11	8889050	missense	probably damaging	1.00
R3855:Pkd1l1	UTSW	11	8965047	critical splice donor site	probably null
R3880:Pkd1l1	UTSW	11	8961983	missense	unknown
R3970:Pkd1l1	UTSW	11	8874218	missense	probably damaging	1.00
R4195:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4196:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4246:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4247:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4249:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4250:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4593:Pkd1l1	UTSW	11	8901253	missense	probably damaging	0.97
R4609:Pkd1l1	UTSW	11	8958964	missense	unknown
R4797:Pkd1l1	UTSW	11	8961340	missense	unknown
R4910:Pkd1l1	UTSW	11	8929360	missense	possibly damaging	0.50
R4940:Pkd1l1	UTSW	11	8844585	missense	probably benign
R5084:Pkd1l1	UTSW	11	8942004	missense	probably benign	0.05
R5147:Pkd1l1	UTSW	11	8849003	missense	possibly damaging	0.71
R5360:Pkd1l1	UTSW	11	8879204	missense	probably benign
R5483:Pkd1l1	UTSW	11	8901141	critical splice donor site	probably null
R5604:Pkd1l1	UTSW	11	8833877	missense	probably damaging	0.98
R5642:Pkd1l1	UTSW	11	8879202	missense	probably damaging	1.00
R5652:Pkd1l1	UTSW	11	8909889	missense	probably benign	0.03
R5751:Pkd1l1	UTSW	11	8867204	missense	possibly damaging	0.45
R5761:Pkd1l1	UTSW	11	8916301	missense	probably damaging	1.00
R5800:Pkd1l1	UTSW	11	8861302	missense	probably benign
R5874:Pkd1l1	UTSW	11	8908688	missense	probably damaging	1.00
R5897:Pkd1l1	UTSW	11	8879176	missense	probably benign	0.03
R5913:Pkd1l1	UTSW	11	8863849	missense	probably benign	0.00
R5930:Pkd1l1	UTSW	11	8958969	missense	unknown
R6000:Pkd1l1	UTSW	11	8950427	missense	probably benign	0.00
R6005:Pkd1l1	UTSW	11	8857113	missense	probably damaging	1.00
R6013:Pkd1l1	UTSW	11	8869452	splice site	probably null
R6027:Pkd1l1	UTSW	11	8916272	nonsense	probably null
R6028:Pkd1l1	UTSW	11	8836267	missense	probably benign	0.06
R6129:Pkd1l1	UTSW	11	8868543	missense	probably benign	0.00
R6182:Pkd1l1	UTSW	11	8865555	missense	probably benign	0.36
R6226:Pkd1l1	UTSW	11	8901287	missense	probably benign	0.00
R6257:Pkd1l1	UTSW	11	8942195	missense	probably benign	0.22
R6340:Pkd1l1	UTSW	11	8844649	missense	probably benign	0.09
R6478:Pkd1l1	UTSW	11	8863911	missense	probably benign	0.00
R6558:Pkd1l1	UTSW	11	8889052	missense	probably benign	0.00
R6750:Pkd1l1	UTSW	11	8973217	missense	unknown
R6987:Pkd1l1	UTSW	11	8902575	missense	probably benign	0.01
R6996:Pkd1l1	UTSW	11	8849046	missense	probably damaging	1.00
R7139:Pkd1l1	UTSW	11	8890737	missense
R7224:Pkd1l1	UTSW	11	8945241	missense
R7244:Pkd1l1	UTSW	11	8871771	missense
R7265:Pkd1l1	UTSW	11	8929402	missense
R7358:Pkd1l1	UTSW	11	8945202	missense
R7387:Pkd1l1	UTSW	11	8901203	missense
R7414:Pkd1l1	UTSW	11	8916267	missense
R7459:Pkd1l1	UTSW	11	8902428	missense
R7478:Pkd1l1	UTSW	11	8929441	missense
R7485:Pkd1l1	UTSW	11	8965148	missense
R7490:Pkd1l1	UTSW	11	8916265	missense
R7644:Pkd1l1	UTSW	11	8875758	missense
R7647:Pkd1l1	UTSW	11	8947296	missense
R7676:Pkd1l1	UTSW	11	8962708	missense
R7687:Pkd1l1	UTSW	11	8854390	missense
R7699:Pkd1l1	UTSW	11	8965142	missense
R7922:Pkd1l1	UTSW	11	8909857	missense
R7980:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R7993:Pkd1l1	UTSW	11	8945262	missense
R8052:Pkd1l1	UTSW	11	8947315	missense
R8125:Pkd1l1	UTSW	11	8947241	missense	probably damaging	1.00
R8420:Pkd1l1	UTSW	11	8870277	nonsense	probably null
R8675:Pkd1l1	UTSW	11	8848916	critical splice donor site	probably null
R8683:Pkd1l1	UTSW	11	8871805	missense
R8709:Pkd1l1	UTSW	11	8855567	missense
R8711:Pkd1l1	UTSW	11	8865550	missense
R8725:Pkd1l1	UTSW	11	8961482	missense
R8733:Pkd1l1	UTSW	11	8933657	missense
R8822:Pkd1l1	UTSW	11	8856312	missense
R8871:Pkd1l1	UTSW	11	8950503	missense
X0024:Pkd1l1	UTSW	11	8950413	missense	probably benign	0.01
X0063:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
X0065:Pkd1l1	UTSW	11	8909921	missense	probably benign	0.10
Z1176:Pkd1l1	UTSW	11	8826801	missense
Z1177:Pkd1l1	UTSW	11	8945208	missense

Predicted Primers

PCR Primer
(F):5'- GGATGGTCTTCAAATCTCACTACTC -3'
(R):5'- ACCCTTTACCAAATGAGTCGTC -3'

Sequencing Primer
(F):5'- TTCTACAGAACACATTCATCACCTTG -3'
(R):5'- TTACCAAATGAGTCGTCTCCTCAAC -3'

Posted On

2020-09-15