Incidental Mutation 'R7922:Rhot1'
ID 648466
Institutional Source Beutler Lab
Gene Symbol Rhot1
Ensembl Gene ENSMUSG00000017686
Gene Name ras homolog family member T1
Synonyms 2210403N23Rik, Arht1, C430039G08Rik, FLJ11040, Miro1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7922 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 80209019-80267907 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80265803 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 655 (T655A)
Ref Sequence ENSEMBL: ENSMUSP00000057669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017831] [ENSMUST00000055056] [ENSMUST00000077451] [ENSMUST00000092857]
AlphaFold Q8BG51
Predicted Effect probably benign
Transcript: ENSMUST00000017831
AA Change: T646A

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000017831
Gene: ENSMUSG00000017686
AA Change: T646A

DomainStartEndE-ValueType
Pfam:Arf 7 177 5.5e-6 PFAM
Pfam:Miro 19 134 2.5e-18 PFAM
Pfam:Ras 19 181 1.4e-20 PFAM
EFh 201 229 6.75e0 SMART
Pfam:EF_assoc_2 231 319 5.3e-36 PFAM
EFh 321 349 1.67e0 SMART
Pfam:EF_assoc_1 353 427 1.8e-33 PFAM
Pfam:Miro 433 543 6.6e-16 PFAM
Pfam:Ras 433 566 1.7e-6 PFAM
transmembrane domain 638 660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055056
AA Change: T655A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000057669
Gene: ENSMUSG00000017686
AA Change: T655A

DomainStartEndE-ValueType
Pfam:Arf 7 177 5.6e-6 PFAM
Pfam:Miro 19 134 2.5e-18 PFAM
Pfam:Ras 19 181 1.4e-20 PFAM
EFh 201 229 6.75e0 SMART
Pfam:EF_assoc_2 231 319 5.4e-36 PFAM
EFh 321 349 1.67e0 SMART
Pfam:EF_assoc_1 353 427 1.8e-33 PFAM
Pfam:Miro 433 543 6.7e-16 PFAM
Pfam:Ras 433 577 1.6e-6 PFAM
transmembrane domain 647 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077451
AA Change: T687A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000076664
Gene: ENSMUSG00000017686
AA Change: T687A

DomainStartEndE-ValueType
Pfam:Roc 19 135 9.4e-11 PFAM
Pfam:Ras 19 181 9.1e-21 PFAM
EFh 201 229 6.75e0 SMART
Pfam:EF_assoc_2 232 318 8.3e-36 PFAM
EFh 321 349 1.67e0 SMART
Pfam:EF_assoc_1 354 426 7e-32 PFAM
Pfam:Ras 433 566 1.5e-6 PFAM
transmembrane domain 679 701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092857
AA Change: T614A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000090533
Gene: ENSMUSG00000017686
AA Change: T614A

DomainStartEndE-ValueType
small_GTPase 15 182 5.1e-8 SMART
EFh 201 229 3.3e-2 SMART
Pfam:EF_assoc_2 231 319 2.9e-33 PFAM
EFh 321 349 8.1e-3 SMART
Pfam:EF_assoc_1 353 427 1e-30 PFAM
Pfam:Miro 433 543 8e-15 PFAM
Pfam:Ras 433 566 2.5e-5 PFAM
transmembrane domain 606 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134894
AA Change: T416A

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117941
Gene: ENSMUSG00000017686
AA Change: T416A

DomainStartEndE-ValueType
Pfam:EF_assoc_2 1 80 1.3e-34 PFAM
Blast:EFh 83 111 2e-10 BLAST
Pfam:EF_assoc_1 116 188 4.3e-33 PFAM
Pfam:Ras 195 331 1.3e-7 PFAM
transmembrane domain 409 431 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele die neonatally exhibiting cyanosis, respiratory failure, loss of brainstem cranial motor neurons, decreased cervical motor neuron number and phrenic nerve branching, and alterations in retrograde mitochondrial transport and run length in cortical axons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,164,406 T638M possibly damaging Het
4930546C10Rik A G 18: 68,949,996 probably null Het
Abi3 A T 11: 95,832,793 Y342N unknown Het
Adk G A 14: 21,318,043 V195I probably benign Het
Ago2 C T 15: 73,126,526 V268M possibly damaging Het
Apaf1 T C 10: 90,999,753 I1077V probably benign Het
Arap1 A T 7: 101,404,414 K1317* probably null Het
Auts2 T A 5: 131,440,373 D493V Het
Baz1b A T 5: 135,231,679 Q1110L probably damaging Het
Brsk2 T A 7: 141,993,220 S467T possibly damaging Het
Btbd9 A T 17: 30,274,884 M511K probably benign Het
Cdh23 T A 10: 60,382,706 Y1385F probably benign Het
Cfap100 A C 6: 90,403,980 L427V unknown Het
Cnga1 A G 5: 72,604,882 F430L possibly damaging Het
Dnhd1 A T 7: 105,668,514 D472V probably damaging Het
Dock2 T A 11: 34,707,327 E339V probably benign Het
Eif3a A T 19: 60,775,842 V379E probably damaging Het
Erich4 T A 7: 25,615,743 N36Y probably damaging Het
Fam60a T A 6: 148,926,146 T125S probably benign Het
Frem2 T C 3: 53,653,304 T1261A probably damaging Het
Fzd6 A T 15: 39,031,108 D223V probably damaging Het
Gabra2 A T 5: 71,007,972 Y218* probably null Het
Gcn1l1 G T 5: 115,614,468 M2177I probably benign Het
Ghr G A 15: 3,341,074 T103I possibly damaging Het
Gipc1 T C 8: 83,661,228 V79A probably benign Het
Gm10031 A T 1: 156,524,992 L254F probably damaging Het
Gm13272 T A 4: 88,780,340 V164D probably damaging Het
Gramd4 C A 15: 86,131,958 H503Q probably benign Het
Gstm4 A T 3: 108,044,671 M1K probably null Het
Heatr5b T A 17: 78,760,559 Q1800L probably benign Het
Hectd1 T A 12: 51,790,195 K826* probably null Het
Hoxa9 T C 6: 52,224,309 I251V possibly damaging Het
Il2ra A T 2: 11,674,366 I46F possibly damaging Het
Ints2 T A 11: 86,244,627 R320S probably benign Het
Iscu A T 5: 113,774,282 N46I probably damaging Het
Iscu G A 5: 113,774,349 R60Q unknown Het
Kcnk3 A T 5: 30,588,531 H72L probably damaging Het
Kmt2a T G 9: 44,842,860 S1228R unknown Het
Mbl2 T A 19: 30,239,238 L150Q probably damaging Het
Med13 A T 11: 86,271,005 F2166Y probably damaging Het
Mterf4 A C 1: 93,301,553 L246* probably null Het
Muc16 T C 9: 18,584,825 Q6690R probably benign Het
Myh10 T A 11: 68,808,893 L1722Q possibly damaging Het
Neurod2 T C 11: 98,327,628 M237V probably benign Het
Olfml1 A G 7: 107,571,149 Y81C probably damaging Het
Olfr735 A G 14: 50,346,415 V9A probably benign Het
Pcdhga7 A T 18: 37,716,173 N411I probably benign Het
Pcdhgb8 T C 18: 37,763,949 F691L probably benign Het
Pik3c2a A G 7: 116,391,282 V481A probably damaging Het
Pik3r6 A T 11: 68,533,875 R435S probably benign Het
Pkd1l1 G A 11: 8,849,013 H2250Y Het
Pkd1l1 A G 11: 8,909,857 S1034P Het
Plcd1 C A 9: 119,074,652 R400L possibly damaging Het
Ppp2r1a A G 17: 20,954,617 T58A probably benign Het
Ppp5c T C 7: 17,027,800 E5G possibly damaging Het
Pradc1 A C 6: 85,447,968 F82L probably benign Het
Prkag3 A T 1: 74,741,257 S416R probably benign Het
Rab3gap2 T C 1: 185,249,920 C390R probably benign Het
Rorc A G 3: 94,391,188 I348V probably damaging Het
Ryr1 A T 7: 29,097,224 V1051E probably benign Het
Sema5b GCAC GC 16: 35,658,256 probably null Het
Serpinb3c G A 1: 107,272,014 T259I probably damaging Het
Sh3gl1 A T 17: 56,019,438 M70K probably damaging Het
Slc7a4 C T 16: 17,573,366 V607I probably benign Het
Spop A T 11: 95,471,328 N62Y probably damaging Het
Spout1 A G 2: 30,176,811 F130S probably benign Het
Tab1 A G 15: 80,158,865 H420R possibly damaging Het
Tecpr2 CA C 12: 110,932,642 probably null Het
Tnxb G C 17: 34,714,603 K2332N probably damaging Het
Togaram1 T C 12: 64,967,738 Y588H probably damaging Het
Trim71 G A 9: 114,513,085 R710C probably damaging Het
Tsen54 C T 11: 115,820,782 Q342* probably null Het
Ube2r2 T A 4: 41,190,812 N235K unknown Het
Utrn C A 10: 12,667,527 K1792N possibly damaging Het
Vmn1r122 A G 7: 21,133,662 I156T possibly damaging Het
Vmn1r94 T C 7: 20,167,711 T223A possibly damaging Het
Vmn2r120 G A 17: 57,524,683 R369W probably damaging Het
Vwa7 G T 17: 35,024,433 A717S possibly damaging Het
Zc3h4 T A 7: 16,425,722 C398S unknown Het
Zc3hc1 T A 6: 30,390,875 E43V possibly damaging Het
Zfp101 A T 17: 33,381,537 V415D possibly damaging Het
Zfp553 A G 7: 127,236,596 H441R probably damaging Het
Other mutations in Rhot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Rhot1 APN 11 80226102 missense probably benign 0.27
IGL01335:Rhot1 APN 11 80250229 missense probably damaging 1.00
IGL01631:Rhot1 APN 11 80265774 missense probably damaging 1.00
IGL03009:Rhot1 APN 11 80220254 splice site probably null
IGL03106:Rhot1 APN 11 80242581 nonsense probably null
R0554:Rhot1 UTSW 11 80243438 nonsense probably null
R0720:Rhot1 UTSW 11 80223943 missense probably damaging 1.00
R1319:Rhot1 UTSW 11 80246021 missense probably damaging 0.98
R3825:Rhot1 UTSW 11 80226081 missense probably damaging 0.98
R4713:Rhot1 UTSW 11 80225602 missense probably benign 0.00
R4917:Rhot1 UTSW 11 80209201 utr 5 prime probably benign
R4971:Rhot1 UTSW 11 80233474 missense probably damaging 1.00
R5159:Rhot1 UTSW 11 80220272 missense probably damaging 1.00
R5177:Rhot1 UTSW 11 80246766 missense possibly damaging 0.90
R5231:Rhot1 UTSW 11 80227334 critical splice donor site probably null
R5659:Rhot1 UTSW 11 80250355 splice site probably null
R5941:Rhot1 UTSW 11 80251170 intron probably benign
R6216:Rhot1 UTSW 11 80251059 missense probably benign 0.00
R6920:Rhot1 UTSW 11 80242095 missense probably benign 0.36
R6984:Rhot1 UTSW 11 80233484 nonsense probably null
R7199:Rhot1 UTSW 11 80246734 missense probably damaging 1.00
R7383:Rhot1 UTSW 11 80223934 missense probably damaging 1.00
R7453:Rhot1 UTSW 11 80248540 critical splice donor site probably null
R7996:Rhot1 UTSW 11 80257537 missense probably damaging 1.00
R8116:Rhot1 UTSW 11 80251053 missense probably benign 0.00
R8298:Rhot1 UTSW 11 80246676 missense probably benign 0.01
R8322:Rhot1 UTSW 11 80257560 missense possibly damaging 0.95
R8371:Rhot1 UTSW 11 80243466 missense probably damaging 1.00
R8408:Rhot1 UTSW 11 80223960 missense probably damaging 1.00
R9155:Rhot1 UTSW 11 80257554 missense probably null 0.59
R9338:Rhot1 UTSW 11 80254742 missense probably benign 0.08
Z1176:Rhot1 UTSW 11 80242621 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGCCTGACAAGTGTGCTAAC -3'
(R):5'- CTTTCCACATGCCAGTCAATAC -3'

Sequencing Primer
(F):5'- CACTTCCCCCAGATGGACAGTTAG -3'
(R):5'- CAGTCAATACTGCAGTCATTACTAGG -3'
Posted On 2020-09-15