Mutagenetix > Incidental Mutation

Incidental Mutation 'R7922:Ints2'

648467

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

045969-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7922 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 86244627 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 320 (R320S)

Ref Sequence

ENSEMBL: ENSMUSP00000018212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

AlphaFold

Q80UK8

Predicted Effect

probably benign
Transcript: ENSMUST00000018212
AA Change: R320S

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: R320S

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108039
AA Change: R320S

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: R320S

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	C	T	12: 71,164,406	T638M	possibly damaging	Het
4930546C10Rik	A	G	18: 68,949,996		probably null	Het
Abi3	A	T	11: 95,832,793	Y342N	unknown	Het
Adk	G	A	14: 21,318,043	V195I	probably benign	Het
Ago2	C	T	15: 73,126,526	V268M	possibly damaging	Het
Apaf1	T	C	10: 90,999,753	I1077V	probably benign	Het
Arap1	A	T	7: 101,404,414	K1317*	probably null	Het
Auts2	T	A	5: 131,440,373	D493V		Het
Baz1b	A	T	5: 135,231,679	Q1110L	probably damaging	Het
Brsk2	T	A	7: 141,993,220	S467T	possibly damaging	Het
Btbd9	A	T	17: 30,274,884	M511K	probably benign	Het
Cdh23	T	A	10: 60,382,706	Y1385F	probably benign	Het
Cfap100	A	C	6: 90,403,980	L427V	unknown	Het
Cnga1	A	G	5: 72,604,882	F430L	possibly damaging	Het
Dnhd1	A	T	7: 105,668,514	D472V	probably damaging	Het
Dock2	T	A	11: 34,707,327	E339V	probably benign	Het
Eif3a	A	T	19: 60,775,842	V379E	probably damaging	Het
Erich4	T	A	7: 25,615,743	N36Y	probably damaging	Het
Fam60a	T	A	6: 148,926,146	T125S	probably benign	Het
Frem2	T	C	3: 53,653,304	T1261A	probably damaging	Het
Fzd6	A	T	15: 39,031,108	D223V	probably damaging	Het
Gabra2	A	T	5: 71,007,972	Y218*	probably null	Het
Gcn1l1	G	T	5: 115,614,468	M2177I	probably benign	Het
Ghr	G	A	15: 3,341,074	T103I	possibly damaging	Het
Gipc1	T	C	8: 83,661,228	V79A	probably benign	Het
Gm10031	A	T	1: 156,524,992	L254F	probably damaging	Het
Gm13272	T	A	4: 88,780,340	V164D	probably damaging	Het
Gramd4	C	A	15: 86,131,958	H503Q	probably benign	Het
Gstm4	A	T	3: 108,044,671	M1K	probably null	Het
Heatr5b	T	A	17: 78,760,559	Q1800L	probably benign	Het
Hectd1	T	A	12: 51,790,195	K826*	probably null	Het
Hoxa9	T	C	6: 52,224,309	I251V	possibly damaging	Het
Il2ra	A	T	2: 11,674,366	I46F	possibly damaging	Het
Iscu	A	T	5: 113,774,282	N46I	probably damaging	Het
Iscu	G	A	5: 113,774,349	R60Q	unknown	Het
Kcnk3	A	T	5: 30,588,531	H72L	probably damaging	Het
Kmt2a	T	G	9: 44,842,860	S1228R	unknown	Het
Mbl2	T	A	19: 30,239,238	L150Q	probably damaging	Het
Med13	A	T	11: 86,271,005	F2166Y	probably damaging	Het
Mterf4	A	C	1: 93,301,553	L246*	probably null	Het
Muc16	T	C	9: 18,584,825	Q6690R	probably benign	Het
Myh10	T	A	11: 68,808,893	L1722Q	possibly damaging	Het
Neurod2	T	C	11: 98,327,628	M237V	probably benign	Het
Olfml1	A	G	7: 107,571,149	Y81C	probably damaging	Het
Olfr735	A	G	14: 50,346,415	V9A	probably benign	Het
Pcdhga7	A	T	18: 37,716,173	N411I	probably benign	Het
Pcdhgb8	T	C	18: 37,763,949	F691L	probably benign	Het
Pik3c2a	A	G	7: 116,391,282	V481A	probably damaging	Het
Pik3r6	A	T	11: 68,533,875	R435S	probably benign	Het
Pkd1l1	G	A	11: 8,849,013	H2250Y		Het
Pkd1l1	A	G	11: 8,909,857	S1034P		Het
Plcd1	C	A	9: 119,074,652	R400L	possibly damaging	Het
Ppp2r1a	A	G	17: 20,954,617	T58A	probably benign	Het
Ppp5c	T	C	7: 17,027,800	E5G	possibly damaging	Het
Pradc1	A	C	6: 85,447,968	F82L	probably benign	Het
Prkag3	A	T	1: 74,741,257	S416R	probably benign	Het
Rab3gap2	T	C	1: 185,249,920	C390R	probably benign	Het
Rhot1	A	G	11: 80,265,803	T655A	probably benign	Het
Rorc	A	G	3: 94,391,188	I348V	probably damaging	Het
Ryr1	A	T	7: 29,097,224	V1051E	probably benign	Het
Sema5b	GCAC	GC	16: 35,658,256		probably null	Het
Serpinb3c	G	A	1: 107,272,014	T259I	probably damaging	Het
Sh3gl1	A	T	17: 56,019,438	M70K	probably damaging	Het
Slc7a4	C	T	16: 17,573,366	V607I	probably benign	Het
Spop	A	T	11: 95,471,328	N62Y	probably damaging	Het
Spout1	A	G	2: 30,176,811	F130S	probably benign	Het
Tab1	A	G	15: 80,158,865	H420R	possibly damaging	Het
Tecpr2	CA	C	12: 110,932,642		probably null	Het
Tnxb	G	C	17: 34,714,603	K2332N	probably damaging	Het
Togaram1	T	C	12: 64,967,738	Y588H	probably damaging	Het
Trim71	G	A	9: 114,513,085	R710C	probably damaging	Het
Tsen54	C	T	11: 115,820,782	Q342*	probably null	Het
Ube2r2	T	A	4: 41,190,812	N235K	unknown	Het
Utrn	C	A	10: 12,667,527	K1792N	possibly damaging	Het
Vmn1r122	A	G	7: 21,133,662	I156T	possibly damaging	Het
Vmn1r94	T	C	7: 20,167,711	T223A	possibly damaging	Het
Vmn2r120	G	A	17: 57,524,683	R369W	probably damaging	Het
Vwa7	G	T	17: 35,024,433	A717S	possibly damaging	Het
Zc3h4	T	A	7: 16,425,722	C398S	unknown	Het
Zc3hc1	T	A	6: 30,390,875	E43V	possibly damaging	Het
Zfp101	A	T	17: 33,381,537	V415D	possibly damaging	Het
Zfp553	A	G	7: 127,236,596	H441R	probably damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACAGACGTAAGAGTGCACTG -3'
(R):5'- GCCTTACCTCTGCAATCAGTG -3'

Sequencing Primer
(F):5'- AAGAGTGCACTGGCTTTCAC -3'
(R):5'- TCAGTGCAAACTGGGGTG -3'

Posted On

2020-09-15