Incidental Mutation 'R7922:Togaram1'
ID648474
Institutional Source Beutler Lab
Gene Symbol Togaram1
Ensembl Gene ENSMUSG00000035614
Gene NameTOG array regulator of axonemal microtubules 1
SynonymsFam179b, A430041B07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.895) question?
Stock #R7922 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location64965804-65022573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64967738 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 588 (Y588H)
Ref Sequence ENSEMBL: ENSMUSP00000152616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021331] [ENSMUST00000066296] [ENSMUST00000222508] [ENSMUST00000223166]
Predicted Effect probably benign
Transcript: ENSMUST00000021331
SMART Domains Protein: ENSMUSP00000021331
Gene: ENSMUSG00000020948

DomainStartEndE-ValueType
BTB 35 132 3.55e-30 SMART
BACK 137 239 1.83e-36 SMART
Kelch 284 331 3.52e-4 SMART
Kelch 332 386 4.23e-7 SMART
Kelch 387 433 1.99e-12 SMART
Kelch 434 479 1.64e-13 SMART
Kelch 480 526 5.12e-15 SMART
Kelch 527 571 5.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066296
AA Change: Y588H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070382
Gene: ENSMUSG00000035614
AA Change: Y588H

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
TOG 339 574 3.38e-23 SMART
low complexity region 804 815 N/A INTRINSIC
low complexity region 988 1001 N/A INTRINSIC
low complexity region 1011 1024 N/A INTRINSIC
low complexity region 1033 1041 N/A INTRINSIC
coiled coil region 1177 1206 N/A INTRINSIC
TOG 1251 1486 4.37e-8 SMART
TOG 1533 1776 1.53e-12 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000222508
Predicted Effect probably damaging
Transcript: ENSMUST00000223166
AA Change: Y588H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,164,406 T638M possibly damaging Het
4930546C10Rik A G 18: 68,949,996 probably null Het
Abi3 A T 11: 95,832,793 Y342N unknown Het
Adk G A 14: 21,318,043 V195I probably benign Het
Ago2 C T 15: 73,126,526 V268M possibly damaging Het
Apaf1 T C 10: 90,999,753 I1077V probably benign Het
Arap1 A T 7: 101,404,414 K1317* probably null Het
Auts2 T A 5: 131,440,373 D493V Het
Baz1b A T 5: 135,231,679 Q1110L probably damaging Het
Brsk2 T A 7: 141,993,220 S467T possibly damaging Het
Btbd9 A T 17: 30,274,884 M511K probably benign Het
Cdh23 T A 10: 60,382,706 Y1385F probably benign Het
Cfap100 A C 6: 90,403,980 L427V unknown Het
Cnga1 A G 5: 72,604,882 F430L possibly damaging Het
Dnhd1 A T 7: 105,668,514 D472V probably damaging Het
Dock2 T A 11: 34,707,327 E339V probably benign Het
Eif3a A T 19: 60,775,842 V379E probably damaging Het
Erich4 T A 7: 25,615,743 N36Y probably damaging Het
Fam60a T A 6: 148,926,146 T125S probably benign Het
Frem2 T C 3: 53,653,304 T1261A probably damaging Het
Fzd6 A T 15: 39,031,108 D223V probably damaging Het
Gabra2 A T 5: 71,007,972 Y218* probably null Het
Gcn1l1 G T 5: 115,614,468 M2177I probably benign Het
Ghr G A 15: 3,341,074 T103I possibly damaging Het
Gipc1 T C 8: 83,661,228 V79A probably benign Het
Gm10031 A T 1: 156,524,992 L254F probably damaging Het
Gm13272 T A 4: 88,780,340 V164D probably damaging Het
Gramd4 C A 15: 86,131,958 H503Q probably benign Het
Gstm4 A T 3: 108,044,671 M1K probably null Het
Heatr5b T A 17: 78,760,559 Q1800L probably benign Het
Hectd1 T A 12: 51,790,195 K826* probably null Het
Hoxa9 T C 6: 52,224,309 I251V possibly damaging Het
Il2ra A T 2: 11,674,366 I46F possibly damaging Het
Ints2 T A 11: 86,244,627 R320S probably benign Het
Iscu A T 5: 113,774,282 N46I probably damaging Het
Iscu G A 5: 113,774,349 R60Q unknown Het
Kcnk3 A T 5: 30,588,531 H72L probably damaging Het
Kmt2a T G 9: 44,842,860 S1228R unknown Het
Mbl2 T A 19: 30,239,238 L150Q probably damaging Het
Med13 A T 11: 86,271,005 F2166Y probably damaging Het
Mterf4 A C 1: 93,301,553 L246* probably null Het
Muc16 T C 9: 18,584,825 Q6690R probably benign Het
Myh10 T A 11: 68,808,893 L1722Q possibly damaging Het
Neurod2 T C 11: 98,327,628 M237V probably benign Het
Olfml1 A G 7: 107,571,149 Y81C probably damaging Het
Olfr735 A G 14: 50,346,415 V9A probably benign Het
Pcdhga7 A T 18: 37,716,173 N411I probably benign Het
Pcdhgb8 T C 18: 37,763,949 F691L probably benign Het
Pik3c2a A G 7: 116,391,282 V481A probably damaging Het
Pik3r6 A T 11: 68,533,875 R435S probably benign Het
Pkd1l1 G A 11: 8,849,013 H2250Y Het
Pkd1l1 A G 11: 8,909,857 S1034P Het
Plcd1 C A 9: 119,074,652 R400L possibly damaging Het
Ppp2r1a A G 17: 20,954,617 T58A probably benign Het
Ppp5c T C 7: 17,027,800 E5G possibly damaging Het
Pradc1 A C 6: 85,447,968 F82L probably benign Het
Prkag3 A T 1: 74,741,257 S416R probably benign Het
Rab3gap2 T C 1: 185,249,920 C390R probably benign Het
Rhot1 A G 11: 80,265,803 T655A probably benign Het
Rorc A G 3: 94,391,188 I348V probably damaging Het
Ryr1 A T 7: 29,097,224 V1051E probably benign Het
Sema5b GCAC GC 16: 35,658,256 probably null Het
Serpinb3c G A 1: 107,272,014 T259I probably damaging Het
Sh3gl1 A T 17: 56,019,438 M70K probably damaging Het
Slc7a4 C T 16: 17,573,366 V607I probably benign Het
Spop A T 11: 95,471,328 N62Y probably damaging Het
Spout1 A G 2: 30,176,811 F130S probably benign Het
Tab1 A G 15: 80,158,865 H420R possibly damaging Het
Tecpr2 CA C 12: 110,932,642 probably null Het
Tnxb G C 17: 34,714,603 K2332N probably damaging Het
Trim71 G A 9: 114,513,085 R710C probably damaging Het
Tsen54 C T 11: 115,820,782 Q342* probably null Het
Ube2r2 T A 4: 41,190,812 N235K unknown Het
Utrn C A 10: 12,667,527 K1792N possibly damaging Het
Vmn1r122 A G 7: 21,133,662 I156T possibly damaging Het
Vmn1r94 T C 7: 20,167,711 T223A possibly damaging Het
Vmn2r120 G A 17: 57,524,683 R369W probably damaging Het
Vwa7 G T 17: 35,024,433 A717S possibly damaging Het
Zc3h4 T A 7: 16,425,722 C398S unknown Het
Zc3hc1 T A 6: 30,390,875 E43V possibly damaging Het
Zfp101 A T 17: 33,381,537 V415D possibly damaging Het
Zfp553 A G 7: 127,236,596 H441R probably damaging Het
Other mutations in Togaram1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Togaram1 APN 12 65006399 missense probably damaging 1.00
IGL01128:Togaram1 APN 12 64980876 missense probably benign 0.01
IGL01406:Togaram1 APN 12 64995578 missense possibly damaging 0.81
IGL01534:Togaram1 APN 12 64966547 missense probably damaging 0.99
IGL01569:Togaram1 APN 12 64982662 missense possibly damaging 0.81
IGL01927:Togaram1 APN 12 64976702 missense probably benign 0.31
IGL02066:Togaram1 APN 12 64983421 missense probably damaging 1.00
IGL02746:Togaram1 APN 12 64966496 nonsense probably null
IGL02878:Togaram1 APN 12 64992626 missense possibly damaging 0.60
IGL02947:Togaram1 APN 12 65021500 missense probably damaging 1.00
IGL02961:Togaram1 APN 12 64966710 missense probably damaging 1.00
PIT4810001:Togaram1 UTSW 12 64983512 missense probably damaging 1.00
R0483:Togaram1 UTSW 12 65007031 missense probably damaging 1.00
R0519:Togaram1 UTSW 12 64966002 unclassified probably benign
R0584:Togaram1 UTSW 12 64967505 missense probably damaging 1.00
R0646:Togaram1 UTSW 12 65021466 missense probably damaging 1.00
R0749:Togaram1 UTSW 12 64982698 missense possibly damaging 0.87
R0891:Togaram1 UTSW 12 64982647 missense probably benign 0.01
R1111:Togaram1 UTSW 12 65006341 missense probably damaging 1.00
R1349:Togaram1 UTSW 12 65011145 missense probably damaging 0.99
R1531:Togaram1 UTSW 12 64966265 missense probably benign 0.01
R1618:Togaram1 UTSW 12 64967073 missense possibly damaging 0.47
R1672:Togaram1 UTSW 12 65021568 missense probably benign 0.00
R1789:Togaram1 UTSW 12 65002635 missense possibly damaging 0.47
R1822:Togaram1 UTSW 12 64995635 missense probably damaging 0.98
R1930:Togaram1 UTSW 12 64966935 missense probably damaging 1.00
R1931:Togaram1 UTSW 12 64966935 missense probably damaging 1.00
R2006:Togaram1 UTSW 12 65019140 missense probably damaging 1.00
R2018:Togaram1 UTSW 12 65002659 missense possibly damaging 0.76
R2304:Togaram1 UTSW 12 64976856 splice site probably null
R2345:Togaram1 UTSW 12 65008632 missense probably benign 0.05
R2407:Togaram1 UTSW 12 64967670 missense probably damaging 1.00
R2853:Togaram1 UTSW 12 65016612 missense probably benign 0.40
R3123:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3124:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3125:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3693:Togaram1 UTSW 12 64983509 missense probably benign 0.34
R3857:Togaram1 UTSW 12 64980859 missense possibly damaging 0.64
R3870:Togaram1 UTSW 12 65002645 missense probably benign 0.00
R3871:Togaram1 UTSW 12 65002645 missense probably benign 0.00
R4398:Togaram1 UTSW 12 64980856 missense probably benign
R4578:Togaram1 UTSW 12 65020326 missense probably damaging 1.00
R4579:Togaram1 UTSW 12 64967907 missense probably damaging 1.00
R4621:Togaram1 UTSW 12 64982450 missense possibly damaging 0.87
R4623:Togaram1 UTSW 12 64982450 missense possibly damaging 0.87
R4655:Togaram1 UTSW 12 64967120 missense possibly damaging 0.91
R5080:Togaram1 UTSW 12 64983403 missense probably benign 0.02
R5459:Togaram1 UTSW 12 64967736 missense probably damaging 1.00
R5652:Togaram1 UTSW 12 65016650 missense probably benign 0.13
R5857:Togaram1 UTSW 12 64995557 missense possibly damaging 0.64
R5997:Togaram1 UTSW 12 64995538 missense probably benign 0.00
R6090:Togaram1 UTSW 12 64967801 missense probably benign 0.07
R6117:Togaram1 UTSW 12 64967487 missense probably damaging 1.00
R6221:Togaram1 UTSW 12 64966546 missense probably damaging 1.00
R6505:Togaram1 UTSW 12 64966590 missense possibly damaging 0.78
R6545:Togaram1 UTSW 12 64978207 missense possibly damaging 0.90
R6706:Togaram1 UTSW 12 65002609 missense probably benign 0.16
R7041:Togaram1 UTSW 12 65020386 missense possibly damaging 0.76
R7199:Togaram1 UTSW 12 64995518 missense probably benign
R7284:Togaram1 UTSW 12 65008680 missense probably benign 0.09
R7451:Togaram1 UTSW 12 64996975 missense probably damaging 1.00
R7504:Togaram1 UTSW 12 64992617 missense possibly damaging 0.79
R7560:Togaram1 UTSW 12 65011142 missense possibly damaging 0.52
R7802:Togaram1 UTSW 12 64966984 nonsense probably null
R7842:Togaram1 UTSW 12 64966459 missense probably damaging 1.00
X0021:Togaram1 UTSW 12 64966184 missense probably benign 0.00
Z1177:Togaram1 UTSW 12 64966208 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TTGTGGATAGCAAACGCAGG -3'
(R):5'- TTCCAGCACTTAAAACCCTTCG -3'

Sequencing Primer
(F):5'- TACGCCAGGCAGCTTTAGAG -3'
(R):5'- CCCTTCGGGTACAGATAGTTGGAC -3'
Posted On2020-09-15