Incidental Mutation 'R7922:2700049A03Rik'
ID 648475
Institutional Source Beutler Lab
Gene Symbol 2700049A03Rik
Ensembl Gene ENSMUSG00000034601
Gene Name RIKEN cDNA 2700049A03 gene
Synonyms talpid3, Ta3
MMRRC Submission 045969-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7922 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 71183622-71290077 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 71211180 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 638 (T638M)
Ref Sequence ENSEMBL: ENSMUSP00000118956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]
AlphaFold E9PV87
Predicted Effect probably damaging
Transcript: ENSMUST00000045907
AA Change: T638M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: T638M

DomainStartEndE-ValueType
Pfam:TALPID3 116 1351 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000149564
AA Change: T638M

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: T638M

DomainStartEndE-ValueType
Pfam:TALPID3 116 1349 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930546C10Rik A G 18: 69,083,067 (GRCm39) probably null Het
Abi3 A T 11: 95,723,619 (GRCm39) Y342N unknown Het
Adk G A 14: 21,368,111 (GRCm39) V195I probably benign Het
Ago2 C T 15: 72,998,375 (GRCm39) V268M possibly damaging Het
Apaf1 T C 10: 90,835,615 (GRCm39) I1077V probably benign Het
Arap1 A T 7: 101,053,621 (GRCm39) K1317* probably null Het
Auts2 T A 5: 131,469,211 (GRCm39) D493V Het
Baz1b A T 5: 135,260,533 (GRCm39) Q1110L probably damaging Het
Brsk2 T A 7: 141,546,957 (GRCm39) S467T possibly damaging Het
Btbd9 A T 17: 30,493,858 (GRCm39) M511K probably benign Het
Cdh23 T A 10: 60,218,485 (GRCm39) Y1385F probably benign Het
Cfap100 A C 6: 90,380,962 (GRCm39) L427V unknown Het
Cnga1 A G 5: 72,762,225 (GRCm39) F430L possibly damaging Het
Csnk2a1-ps3 A T 1: 156,352,562 (GRCm39) L254F probably damaging Het
Dnhd1 A T 7: 105,317,721 (GRCm39) D472V probably damaging Het
Dock2 T A 11: 34,598,154 (GRCm39) E339V probably benign Het
Eif3a A T 19: 60,764,280 (GRCm39) V379E probably damaging Het
Erich4 T A 7: 25,315,168 (GRCm39) N36Y probably damaging Het
Frem2 T C 3: 53,560,725 (GRCm39) T1261A probably damaging Het
Fzd6 A T 15: 38,894,503 (GRCm39) D223V probably damaging Het
Gabra2 A T 5: 71,165,315 (GRCm39) Y218* probably null Het
Gcn1 G T 5: 115,752,527 (GRCm39) M2177I probably benign Het
Ghr G A 15: 3,370,556 (GRCm39) T103I possibly damaging Het
Gipc1 T C 8: 84,387,857 (GRCm39) V79A probably benign Het
Gm13272 T A 4: 88,698,577 (GRCm39) V164D probably damaging Het
Gramd4 C A 15: 86,016,159 (GRCm39) H503Q probably benign Het
Gstm4 A T 3: 107,951,987 (GRCm39) M1K probably null Het
Heatr5b T A 17: 79,067,988 (GRCm39) Q1800L probably benign Het
Hectd1 T A 12: 51,836,978 (GRCm39) K826* probably null Het
Hoxa9 T C 6: 52,201,289 (GRCm39) I251V possibly damaging Het
Il2ra A T 2: 11,679,177 (GRCm39) I46F possibly damaging Het
Ints2 T A 11: 86,135,453 (GRCm39) R320S probably benign Het
Iscu A T 5: 113,912,343 (GRCm39) N46I probably damaging Het
Iscu G A 5: 113,912,410 (GRCm39) R60Q unknown Het
Kcnk3 A T 5: 30,745,875 (GRCm39) H72L probably damaging Het
Kmt2a T G 9: 44,754,157 (GRCm39) S1228R unknown Het
Mbl2 T A 19: 30,216,638 (GRCm39) L150Q probably damaging Het
Med13 A T 11: 86,161,831 (GRCm39) F2166Y probably damaging Het
Mterf4 A C 1: 93,229,275 (GRCm39) L246* probably null Het
Muc16 T C 9: 18,496,121 (GRCm39) Q6690R probably benign Het
Myh10 T A 11: 68,699,719 (GRCm39) L1722Q possibly damaging Het
Neurod2 T C 11: 98,218,454 (GRCm39) M237V probably benign Het
Olfml1 A G 7: 107,170,356 (GRCm39) Y81C probably damaging Het
Or4q3 A G 14: 50,583,872 (GRCm39) V9A probably benign Het
Pcdhga7 A T 18: 37,849,226 (GRCm39) N411I probably benign Het
Pcdhgb8 T C 18: 37,897,002 (GRCm39) F691L probably benign Het
Pik3c2a A G 7: 115,990,517 (GRCm39) V481A probably damaging Het
Pik3r6 A T 11: 68,424,701 (GRCm39) R435S probably benign Het
Pkd1l1 G A 11: 8,799,013 (GRCm39) H2250Y Het
Pkd1l1 A G 11: 8,859,857 (GRCm39) S1034P Het
Plcd1 C A 9: 118,903,720 (GRCm39) R400L possibly damaging Het
Ppp2r1a A G 17: 21,174,879 (GRCm39) T58A probably benign Het
Ppp5c T C 7: 16,761,725 (GRCm39) E5G possibly damaging Het
Pradc1 A C 6: 85,424,950 (GRCm39) F82L probably benign Het
Prkag3 A T 1: 74,780,416 (GRCm39) S416R probably benign Het
Rab3gap2 T C 1: 184,982,117 (GRCm39) C390R probably benign Het
Rhot1 A G 11: 80,156,629 (GRCm39) T655A probably benign Het
Rorc A G 3: 94,298,495 (GRCm39) I348V probably damaging Het
Ryr1 A T 7: 28,796,649 (GRCm39) V1051E probably benign Het
Sema5b GCAC GC 16: 35,478,626 (GRCm39) probably null Het
Serpinb3c G A 1: 107,199,744 (GRCm39) T259I probably damaging Het
Sh3gl1 A T 17: 56,326,438 (GRCm39) M70K probably damaging Het
Sinhcaf T A 6: 148,827,644 (GRCm39) T125S probably benign Het
Slc7a4 C T 16: 17,391,230 (GRCm39) V607I probably benign Het
Spop A T 11: 95,362,154 (GRCm39) N62Y probably damaging Het
Spout1 A G 2: 30,066,823 (GRCm39) F130S probably benign Het
Tab1 A G 15: 80,043,066 (GRCm39) H420R possibly damaging Het
Tecpr2 CA C 12: 110,899,076 (GRCm39) probably null Het
Tnxb G C 17: 34,933,577 (GRCm39) K2332N probably damaging Het
Togaram1 T C 12: 65,014,512 (GRCm39) Y588H probably damaging Het
Trim71 G A 9: 114,342,153 (GRCm39) R710C probably damaging Het
Tsen54 C T 11: 115,711,608 (GRCm39) Q342* probably null Het
Ube2r2 T A 4: 41,190,812 (GRCm39) N235K unknown Het
Utrn C A 10: 12,543,271 (GRCm39) K1792N possibly damaging Het
Vmn1r122 A G 7: 20,867,587 (GRCm39) I156T possibly damaging Het
Vmn1r94 T C 7: 19,901,636 (GRCm39) T223A possibly damaging Het
Vmn2r120 G A 17: 57,831,683 (GRCm39) R369W probably damaging Het
Vwa7 G T 17: 35,243,409 (GRCm39) A717S possibly damaging Het
Zc3h4 T A 7: 16,159,647 (GRCm39) C398S unknown Het
Zc3hc1 T A 6: 30,390,874 (GRCm39) E43V possibly damaging Het
Zfp101 A T 17: 33,600,511 (GRCm39) V415D possibly damaging Het
Zfp553 A G 7: 126,835,768 (GRCm39) H441R probably damaging Het
Other mutations in 2700049A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:2700049A03Rik APN 12 71,213,893 (GRCm39) missense probably benign 0.00
IGL01107:2700049A03Rik APN 12 71,241,242 (GRCm39) critical splice donor site probably null
IGL01404:2700049A03Rik APN 12 71,211,152 (GRCm39) splice site probably null
IGL01835:2700049A03Rik APN 12 71,213,957 (GRCm39) missense probably benign 0.00
IGL01835:2700049A03Rik APN 12 71,213,955 (GRCm39) nonsense probably null
IGL02122:2700049A03Rik APN 12 71,217,299 (GRCm39) missense possibly damaging 0.93
IGL02140:2700049A03Rik APN 12 71,195,034 (GRCm39) missense probably benign 0.06
IGL02385:2700049A03Rik APN 12 71,201,630 (GRCm39) missense probably damaging 0.98
IGL03181:2700049A03Rik APN 12 71,240,147 (GRCm39) missense possibly damaging 0.51
IGL03253:2700049A03Rik APN 12 71,187,657 (GRCm39) missense probably benign 0.33
IGL03278:2700049A03Rik APN 12 71,205,599 (GRCm39) splice site probably benign
G4846:2700049A03Rik UTSW 12 71,184,683 (GRCm39) missense probably benign
PIT1430001:2700049A03Rik UTSW 12 71,207,160 (GRCm39) missense possibly damaging 0.71
PIT4519001:2700049A03Rik UTSW 12 71,217,440 (GRCm39) missense probably benign 0.05
R0108:2700049A03Rik UTSW 12 71,224,692 (GRCm39) missense probably benign 0.14
R0165:2700049A03Rik UTSW 12 71,213,924 (GRCm39) missense possibly damaging 0.52
R0211:2700049A03Rik UTSW 12 71,262,870 (GRCm39) missense possibly damaging 0.96
R0211:2700049A03Rik UTSW 12 71,262,870 (GRCm39) missense possibly damaging 0.96
R0220:2700049A03Rik UTSW 12 71,195,194 (GRCm39) critical splice donor site probably null
R0352:2700049A03Rik UTSW 12 71,184,804 (GRCm39) missense possibly damaging 0.96
R0468:2700049A03Rik UTSW 12 71,240,084 (GRCm39) missense possibly damaging 0.71
R0508:2700049A03Rik UTSW 12 71,211,162 (GRCm39) missense probably damaging 0.98
R0673:2700049A03Rik UTSW 12 71,224,642 (GRCm39) missense probably damaging 0.97
R0840:2700049A03Rik UTSW 12 71,205,657 (GRCm39) missense probably benign 0.16
R0893:2700049A03Rik UTSW 12 71,266,082 (GRCm39) splice site probably benign
R1244:2700049A03Rik UTSW 12 71,262,918 (GRCm39) missense probably benign 0.25
R1432:2700049A03Rik UTSW 12 71,217,361 (GRCm39) splice site probably null
R1599:2700049A03Rik UTSW 12 71,197,033 (GRCm39) missense probably damaging 0.98
R1732:2700049A03Rik UTSW 12 71,265,995 (GRCm39) missense probably benign 0.18
R1820:2700049A03Rik UTSW 12 71,197,018 (GRCm39) missense possibly damaging 0.51
R1939:2700049A03Rik UTSW 12 71,207,186 (GRCm39) splice site probably null
R1998:2700049A03Rik UTSW 12 71,235,393 (GRCm39) missense possibly damaging 0.86
R2337:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2337:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2340:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2340:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2382:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2382:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2384:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2384:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2445:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2445:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2449:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2449:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2512:2700049A03Rik UTSW 12 71,219,945 (GRCm39) missense possibly damaging 0.71
R2872:2700049A03Rik UTSW 12 71,201,530 (GRCm39) splice site probably benign
R3236:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3236:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3237:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3237:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3734:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3734:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3808:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3808:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3809:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3809:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3944:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3944:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3959:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3959:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3960:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3960:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4593:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4593:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4595:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4595:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4596:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4596:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4600:2700049A03Rik UTSW 12 71,195,037 (GRCm39) missense possibly damaging 0.67
R4649:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4649:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4652:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4652:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4714:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4714:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4735:2700049A03Rik UTSW 12 71,262,897 (GRCm39) missense possibly damaging 0.88
R4810:2700049A03Rik UTSW 12 71,236,216 (GRCm39) missense possibly damaging 0.51
R4852:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4852:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4854:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4854:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4855:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4855:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4884:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4884:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4893:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4893:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4905:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4905:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4915:2700049A03Rik UTSW 12 71,236,420 (GRCm39) missense possibly damaging 0.92
R4919:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4919:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4959:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4959:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4989:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4989:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5011:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5011:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5012:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5012:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5118:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5118:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5146:2700049A03Rik UTSW 12 71,289,799 (GRCm39) missense possibly damaging 0.85
R5163:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5163:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5188:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5188:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5189:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71,240,123 (GRCm39) missense possibly damaging 0.93
R5190:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5190:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5290:2700049A03Rik UTSW 12 71,235,565 (GRCm39) missense probably benign 0.00
R5344:2700049A03Rik UTSW 12 71,289,801 (GRCm39) missense probably benign
R5502:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5502:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5503:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5503:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5619:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5619:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5667:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5667:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5669:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5669:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5671:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5671:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5725:2700049A03Rik UTSW 12 71,240,093 (GRCm39) missense probably benign 0.05
R5956:2700049A03Rik UTSW 12 71,203,893 (GRCm39) missense possibly damaging 0.86
R6051:2700049A03Rik UTSW 12 71,231,304 (GRCm39) missense possibly damaging 0.84
R6148:2700049A03Rik UTSW 12 71,234,200 (GRCm39) missense possibly damaging 0.71
R6158:2700049A03Rik UTSW 12 71,217,410 (GRCm39) missense possibly damaging 0.51
R6916:2700049A03Rik UTSW 12 71,211,318 (GRCm39) missense possibly damaging 0.86
R7129:2700049A03Rik UTSW 12 71,263,004 (GRCm39) splice site probably null
R7168:2700049A03Rik UTSW 12 71,262,831 (GRCm39) missense probably damaging 0.98
R7193:2700049A03Rik UTSW 12 71,265,963 (GRCm39) critical splice acceptor site probably null
R7200:2700049A03Rik UTSW 12 71,187,680 (GRCm39) missense probably damaging 0.96
R7359:2700049A03Rik UTSW 12 71,236,348 (GRCm39) missense possibly damaging 0.51
R7488:2700049A03Rik UTSW 12 71,197,179 (GRCm39) missense possibly damaging 0.67
R7755:2700049A03Rik UTSW 12 71,236,187 (GRCm39) missense probably benign 0.02
R7757:2700049A03Rik UTSW 12 71,236,187 (GRCm39) missense probably benign 0.02
R7966:2700049A03Rik UTSW 12 71,219,903 (GRCm39) missense probably benign 0.00
R8082:2700049A03Rik UTSW 12 71,188,895 (GRCm39) critical splice donor site probably null
R8311:2700049A03Rik UTSW 12 71,184,815 (GRCm39) unclassified probably benign
R8408:2700049A03Rik UTSW 12 71,236,356 (GRCm39) missense possibly damaging 0.71
R8852:2700049A03Rik UTSW 12 71,231,197 (GRCm39) missense possibly damaging 0.93
R8860:2700049A03Rik UTSW 12 71,231,197 (GRCm39) missense possibly damaging 0.93
R9039:2700049A03Rik UTSW 12 71,213,849 (GRCm39) missense possibly damaging 0.51
R9281:2700049A03Rik UTSW 12 71,205,687 (GRCm39) missense possibly damaging 0.51
R9308:2700049A03Rik UTSW 12 71,231,233 (GRCm39) missense probably benign 0.23
R9385:2700049A03Rik UTSW 12 71,207,966 (GRCm39) missense possibly damaging 0.52
R9412:2700049A03Rik UTSW 12 71,235,457 (GRCm39) missense possibly damaging 0.71
R9643:2700049A03Rik UTSW 12 71,211,189 (GRCm39) missense possibly damaging 0.92
R9676:2700049A03Rik UTSW 12 71,207,905 (GRCm39) missense possibly damaging 0.86
R9776:2700049A03Rik UTSW 12 71,235,448 (GRCm39) missense possibly damaging 0.71
R9789:2700049A03Rik UTSW 12 71,231,357 (GRCm39) missense probably benign
Z1177:2700049A03Rik UTSW 12 71,211,258 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATTGAAAGTGGAGCCTGG -3'
(R):5'- CCTCTCTGTAAATGGAGCAGTG -3'

Sequencing Primer
(F):5'- GTGGAGCCTGGAGTATATAAAGTC -3'
(R):5'- TCTCTGTAAATGGAGCAGTGACAGG -3'
Posted On 2020-09-15