Incidental Mutation 'R7922:Tecpr2'
ID 648476
Institutional Source Beutler Lab
Gene Symbol Tecpr2
Ensembl Gene ENSMUSG00000021275
Gene Name tectonin beta-propeller repeat containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7922 (G1)
Quality Score 217.468
Status Not validated
Chromosome 12
Chromosomal Location 110889264-110972394 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) CA to C at 110932642 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165978] [ENSMUST00000169597] [ENSMUST00000223210]
AlphaFold Q3UH45
Predicted Effect probably null
Transcript: ENSMUST00000165978
SMART Domains Protein: ENSMUSP00000127949
Gene: ENSMUSG00000021275

DomainStartEndE-ValueType
WD40 21 61 8.52e1 SMART
WD40 65 105 2.54e2 SMART
WD40 113 155 2.49e-1 SMART
TECPR 280 314 9.81e0 SMART
TECPR 316 353 2.55e0 SMART
low complexity region 392 424 N/A INTRINSIC
low complexity region 464 471 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 655 670 N/A INTRINSIC
TECPR 814 850 2.28e2 SMART
TECPR 898 931 1.79e-1 SMART
TECPR 939 974 5.61e-3 SMART
TECPR 985 1023 1.55e-5 SMART
TECPR 1173 1208 1.29e-2 SMART
TECPR 1216 1255 2.82e-8 SMART
TECPR 1266 1308 1.05e-7 SMART
TECPR 1317 1351 1.42e-4 SMART
TECPR 1360 1394 5.03e-5 SMART
low complexity region 1414 1421 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169597
SMART Domains Protein: ENSMUSP00000126749
Gene: ENSMUSG00000021275

DomainStartEndE-ValueType
WD40 21 61 8.52e1 SMART
WD40 65 105 2.54e2 SMART
WD40 113 155 2.49e-1 SMART
TECPR 280 314 9.81e0 SMART
TECPR 316 353 2.55e0 SMART
low complexity region 392 424 N/A INTRINSIC
low complexity region 464 471 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 655 670 N/A INTRINSIC
TECPR 814 850 2.28e2 SMART
TECPR 898 931 1.79e-1 SMART
TECPR 939 974 5.61e-3 SMART
TECPR 985 1023 1.55e-5 SMART
TECPR 1173 1208 1.29e-2 SMART
TECPR 1216 1255 2.82e-8 SMART
TECPR 1266 1308 1.05e-7 SMART
TECPR 1317 1351 1.42e-4 SMART
TECPR 1360 1394 5.03e-5 SMART
low complexity region 1414 1421 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223210
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tectonin beta-propeller repeat-containing (TECPR) family, and contains both TECPR and tryptophan-aspartic acid repeat (WD repeat) domains. This gene has been implicated in autophagy, as reduced expression levels of this gene have been associated with impaired autophagy. Recessive mutations in this gene have been associated with a hereditary form of spastic paraparesis (HSP). HSP is characterized by progressive spasticity and paralysis of the legs. There is also some evidence linking mutations in this gene with birdshot chorioretinopathy (BSCR), which results in inflammation of the choroid and retina. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,164,406 T638M possibly damaging Het
4930546C10Rik A G 18: 68,949,996 probably null Het
Abi3 A T 11: 95,832,793 Y342N unknown Het
Adk G A 14: 21,318,043 V195I probably benign Het
Ago2 C T 15: 73,126,526 V268M possibly damaging Het
Apaf1 T C 10: 90,999,753 I1077V probably benign Het
Arap1 A T 7: 101,404,414 K1317* probably null Het
Auts2 T A 5: 131,440,373 D493V Het
Baz1b A T 5: 135,231,679 Q1110L probably damaging Het
Brsk2 T A 7: 141,993,220 S467T possibly damaging Het
Btbd9 A T 17: 30,274,884 M511K probably benign Het
Cdh23 T A 10: 60,382,706 Y1385F probably benign Het
Cfap100 A C 6: 90,403,980 L427V unknown Het
Cnga1 A G 5: 72,604,882 F430L possibly damaging Het
Dnhd1 A T 7: 105,668,514 D472V probably damaging Het
Dock2 T A 11: 34,707,327 E339V probably benign Het
Eif3a A T 19: 60,775,842 V379E probably damaging Het
Erich4 T A 7: 25,615,743 N36Y probably damaging Het
Fam60a T A 6: 148,926,146 T125S probably benign Het
Frem2 T C 3: 53,653,304 T1261A probably damaging Het
Fzd6 A T 15: 39,031,108 D223V probably damaging Het
Gabra2 A T 5: 71,007,972 Y218* probably null Het
Gcn1l1 G T 5: 115,614,468 M2177I probably benign Het
Ghr G A 15: 3,341,074 T103I possibly damaging Het
Gipc1 T C 8: 83,661,228 V79A probably benign Het
Gm10031 A T 1: 156,524,992 L254F probably damaging Het
Gm13272 T A 4: 88,780,340 V164D probably damaging Het
Gramd4 C A 15: 86,131,958 H503Q probably benign Het
Gstm4 A T 3: 108,044,671 M1K probably null Het
Heatr5b T A 17: 78,760,559 Q1800L probably benign Het
Hectd1 T A 12: 51,790,195 K826* probably null Het
Hoxa9 T C 6: 52,224,309 I251V possibly damaging Het
Il2ra A T 2: 11,674,366 I46F possibly damaging Het
Ints2 T A 11: 86,244,627 R320S probably benign Het
Iscu G A 5: 113,774,349 R60Q unknown Het
Iscu A T 5: 113,774,282 N46I probably damaging Het
Kcnk3 A T 5: 30,588,531 H72L probably damaging Het
Kmt2a T G 9: 44,842,860 S1228R unknown Het
Mbl2 T A 19: 30,239,238 L150Q probably damaging Het
Med13 A T 11: 86,271,005 F2166Y probably damaging Het
Mterf4 A C 1: 93,301,553 L246* probably null Het
Muc16 T C 9: 18,584,825 Q6690R probably benign Het
Myh10 T A 11: 68,808,893 L1722Q possibly damaging Het
Neurod2 T C 11: 98,327,628 M237V probably benign Het
Olfml1 A G 7: 107,571,149 Y81C probably damaging Het
Olfr735 A G 14: 50,346,415 V9A probably benign Het
Pcdhga7 A T 18: 37,716,173 N411I probably benign Het
Pcdhgb8 T C 18: 37,763,949 F691L probably benign Het
Pik3c2a A G 7: 116,391,282 V481A probably damaging Het
Pik3r6 A T 11: 68,533,875 R435S probably benign Het
Pkd1l1 G A 11: 8,849,013 H2250Y Het
Pkd1l1 A G 11: 8,909,857 S1034P Het
Plcd1 C A 9: 119,074,652 R400L possibly damaging Het
Ppp2r1a A G 17: 20,954,617 T58A probably benign Het
Ppp5c T C 7: 17,027,800 E5G possibly damaging Het
Pradc1 A C 6: 85,447,968 F82L probably benign Het
Prkag3 A T 1: 74,741,257 S416R probably benign Het
Rab3gap2 T C 1: 185,249,920 C390R probably benign Het
Rhot1 A G 11: 80,265,803 T655A probably benign Het
Rorc A G 3: 94,391,188 I348V probably damaging Het
Ryr1 A T 7: 29,097,224 V1051E probably benign Het
Sema5b GCAC GC 16: 35,658,256 probably null Het
Serpinb3c G A 1: 107,272,014 T259I probably damaging Het
Sh3gl1 A T 17: 56,019,438 M70K probably damaging Het
Slc7a4 C T 16: 17,573,366 V607I probably benign Het
Spop A T 11: 95,471,328 N62Y probably damaging Het
Spout1 A G 2: 30,176,811 F130S probably benign Het
Tab1 A G 15: 80,158,865 H420R possibly damaging Het
Tnxb G C 17: 34,714,603 K2332N probably damaging Het
Togaram1 T C 12: 64,967,738 Y588H probably damaging Het
Trim71 G A 9: 114,513,085 R710C probably damaging Het
Tsen54 C T 11: 115,820,782 Q342* probably null Het
Ube2r2 T A 4: 41,190,812 N235K unknown Het
Utrn C A 10: 12,667,527 K1792N possibly damaging Het
Vmn1r122 A G 7: 21,133,662 I156T possibly damaging Het
Vmn1r94 T C 7: 20,167,711 T223A possibly damaging Het
Vmn2r120 G A 17: 57,524,683 R369W probably damaging Het
Vwa7 G T 17: 35,024,433 A717S possibly damaging Het
Zc3h4 T A 7: 16,425,722 C398S unknown Het
Zc3hc1 T A 6: 30,390,875 E43V possibly damaging Het
Zfp101 A T 17: 33,381,537 V415D possibly damaging Het
Zfp553 A G 7: 127,236,596 H441R probably damaging Het
Other mutations in Tecpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Tecpr2 APN 12 110967779 missense possibly damaging 0.67
IGL01759:Tecpr2 APN 12 110931392 utr 3 prime probably benign
IGL02114:Tecpr2 APN 12 110968887 missense probably damaging 1.00
IGL02813:Tecpr2 APN 12 110933192 missense probably damaging 1.00
IGL02943:Tecpr2 APN 12 110967749 missense probably benign
IGL03085:Tecpr2 APN 12 110954826 splice site probably benign
IGL03290:Tecpr2 APN 12 110967833 missense possibly damaging 0.65
R0362:Tecpr2 UTSW 12 110968940 missense probably damaging 0.96
R0486:Tecpr2 UTSW 12 110896369 missense probably benign 0.01
R0662:Tecpr2 UTSW 12 110896228 missense probably benign 0.02
R0787:Tecpr2 UTSW 12 110946343 missense probably benign 0.30
R1147:Tecpr2 UTSW 12 110941438 splice site probably benign
R1454:Tecpr2 UTSW 12 110968953 missense probably benign 0.00
R1513:Tecpr2 UTSW 12 110954800 missense possibly damaging 0.94
R1567:Tecpr2 UTSW 12 110941596 critical splice donor site probably null
R1569:Tecpr2 UTSW 12 110944887 critical splice donor site probably null
R1818:Tecpr2 UTSW 12 110926454 missense probably damaging 1.00
R1856:Tecpr2 UTSW 12 110933064 missense probably benign
R1897:Tecpr2 UTSW 12 110933247 missense probably benign
R1903:Tecpr2 UTSW 12 110947912 missense probably damaging 0.98
R1939:Tecpr2 UTSW 12 110933169 missense probably damaging 0.98
R1982:Tecpr2 UTSW 12 110954785 missense probably benign 0.07
R2073:Tecpr2 UTSW 12 110968429 missense possibly damaging 0.51
R2393:Tecpr2 UTSW 12 110926402 missense probably damaging 0.99
R2443:Tecpr2 UTSW 12 110896325 missense probably damaging 1.00
R2484:Tecpr2 UTSW 12 110933318 missense probably benign
R4564:Tecpr2 UTSW 12 110954785 missense probably benign 0.07
R4723:Tecpr2 UTSW 12 110932976 missense probably benign 0.01
R4835:Tecpr2 UTSW 12 110954730 missense probably benign 0.00
R4847:Tecpr2 UTSW 12 110939877 missense probably damaging 1.00
R4911:Tecpr2 UTSW 12 110931487 missense possibly damaging 0.74
R5179:Tecpr2 UTSW 12 110944693 missense possibly damaging 0.63
R5266:Tecpr2 UTSW 12 110915402 missense probably damaging 1.00
R5386:Tecpr2 UTSW 12 110915453 missense probably damaging 1.00
R5486:Tecpr2 UTSW 12 110933015 missense probably benign 0.03
R5490:Tecpr2 UTSW 12 110914684 missense probably damaging 1.00
R5627:Tecpr2 UTSW 12 110941482 missense probably damaging 0.97
R5836:Tecpr2 UTSW 12 110931511 missense possibly damaging 0.76
R6052:Tecpr2 UTSW 12 110918891 missense possibly damaging 0.89
R6084:Tecpr2 UTSW 12 110929109 missense probably damaging 0.98
R6306:Tecpr2 UTSW 12 110944751 missense probably damaging 1.00
R6563:Tecpr2 UTSW 12 110929087 missense probably benign 0.00
R6936:Tecpr2 UTSW 12 110944863 missense possibly damaging 0.83
R6977:Tecpr2 UTSW 12 110939766 missense probably benign 0.17
R7110:Tecpr2 UTSW 12 110918972 missense probably damaging 1.00
R7132:Tecpr2 UTSW 12 110915372 missense probably damaging 0.97
R7353:Tecpr2 UTSW 12 110967844 missense probably benign 0.06
R7362:Tecpr2 UTSW 12 110941476 missense possibly damaging 0.85
R7366:Tecpr2 UTSW 12 110915480 critical splice donor site probably null
R7404:Tecpr2 UTSW 12 110931604 missense probably benign 0.00
R7478:Tecpr2 UTSW 12 110968439 missense probably benign 0.36
R7774:Tecpr2 UTSW 12 110933172 missense probably benign 0.00
R7997:Tecpr2 UTSW 12 110933603 missense probably benign 0.02
R8037:Tecpr2 UTSW 12 110936420 missense probably benign 0.03
R8038:Tecpr2 UTSW 12 110936420 missense probably benign 0.03
R8393:Tecpr2 UTSW 12 110944757 missense probably damaging 0.99
R8411:Tecpr2 UTSW 12 110931720 missense possibly damaging 0.63
R8726:Tecpr2 UTSW 12 110938234 missense possibly damaging 0.82
R9155:Tecpr2 UTSW 12 110914750 missense probably damaging 1.00
R9259:Tecpr2 UTSW 12 110931433 missense possibly damaging 0.87
R9279:Tecpr2 UTSW 12 110929071 missense possibly damaging 0.56
R9562:Tecpr2 UTSW 12 110947707 missense possibly damaging 0.65
Z1176:Tecpr2 UTSW 12 110896310 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCATTTCACTGGACATTGTTG -3'
(R):5'- AGGACCACTGTTTTCCTGTGAG -3'

Sequencing Primer
(F):5'- GGAACTTACTGTGTAGCTCAGACC -3'
(R):5'- GTGAGATTCCATTCACCTCACC -3'
Posted On 2020-09-15