Incidental Mutation 'R7922:Adk'
ID 648477
Institutional Source Beutler Lab
Gene Symbol Adk
Ensembl Gene ENSMUSG00000039197
Gene Name adenosine kinase
Synonyms AK, 2310026J05Rik, 5033405D03Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7922 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 21052574-21448569 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 21318043 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 195 (V195I)
Ref Sequence ENSEMBL: ENSMUSP00000047665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045376] [ENSMUST00000223915] [ENSMUST00000224069]
AlphaFold P55264
Predicted Effect probably benign
Transcript: ENSMUST00000045376
AA Change: V195I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047665
Gene: ENSMUSG00000039197
AA Change: V195I

DomainStartEndE-ValueType
Pfam:PfkB 41 359 1.1e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223645
Predicted Effect probably benign
Transcript: ENSMUST00000223915
Predicted Effect probably benign
Transcript: ENSMUST00000224069
AA Change: V179I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene an enzyme which catalyzes the transfer of the gamma-phosphate from ATP to adenosine, thereby serving as a regulator of concentrations of both extracellular adenosine and intracellular adenine nucleotides. Adenosine has widespread effects on the cardiovascular, nervous, respiratory, and immune systems and inhibitors of the enzyme could play an important pharmacological role in increasing intravascular adenosine concentrations and acting as anti-inflammatory agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this gene results in death before 14 days of age, growth retardation, liver abnormalities, apnea, and impaired temperature regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,164,406 T638M possibly damaging Het
4930546C10Rik A G 18: 68,949,996 probably null Het
Abi3 A T 11: 95,832,793 Y342N unknown Het
Ago2 C T 15: 73,126,526 V268M possibly damaging Het
Apaf1 T C 10: 90,999,753 I1077V probably benign Het
Arap1 A T 7: 101,404,414 K1317* probably null Het
Auts2 T A 5: 131,440,373 D493V Het
Baz1b A T 5: 135,231,679 Q1110L probably damaging Het
Brsk2 T A 7: 141,993,220 S467T possibly damaging Het
Btbd9 A T 17: 30,274,884 M511K probably benign Het
Cdh23 T A 10: 60,382,706 Y1385F probably benign Het
Cfap100 A C 6: 90,403,980 L427V unknown Het
Cnga1 A G 5: 72,604,882 F430L possibly damaging Het
Dnhd1 A T 7: 105,668,514 D472V probably damaging Het
Dock2 T A 11: 34,707,327 E339V probably benign Het
Eif3a A T 19: 60,775,842 V379E probably damaging Het
Erich4 T A 7: 25,615,743 N36Y probably damaging Het
Fam60a T A 6: 148,926,146 T125S probably benign Het
Frem2 T C 3: 53,653,304 T1261A probably damaging Het
Fzd6 A T 15: 39,031,108 D223V probably damaging Het
Gabra2 A T 5: 71,007,972 Y218* probably null Het
Gcn1l1 G T 5: 115,614,468 M2177I probably benign Het
Ghr G A 15: 3,341,074 T103I possibly damaging Het
Gipc1 T C 8: 83,661,228 V79A probably benign Het
Gm10031 A T 1: 156,524,992 L254F probably damaging Het
Gm13272 T A 4: 88,780,340 V164D probably damaging Het
Gramd4 C A 15: 86,131,958 H503Q probably benign Het
Gstm4 A T 3: 108,044,671 M1K probably null Het
Heatr5b T A 17: 78,760,559 Q1800L probably benign Het
Hectd1 T A 12: 51,790,195 K826* probably null Het
Hoxa9 T C 6: 52,224,309 I251V possibly damaging Het
Il2ra A T 2: 11,674,366 I46F possibly damaging Het
Ints2 T A 11: 86,244,627 R320S probably benign Het
Iscu A T 5: 113,774,282 N46I probably damaging Het
Iscu G A 5: 113,774,349 R60Q unknown Het
Kcnk3 A T 5: 30,588,531 H72L probably damaging Het
Kmt2a T G 9: 44,842,860 S1228R unknown Het
Mbl2 T A 19: 30,239,238 L150Q probably damaging Het
Med13 A T 11: 86,271,005 F2166Y probably damaging Het
Mterf4 A C 1: 93,301,553 L246* probably null Het
Muc16 T C 9: 18,584,825 Q6690R probably benign Het
Myh10 T A 11: 68,808,893 L1722Q possibly damaging Het
Neurod2 T C 11: 98,327,628 M237V probably benign Het
Olfml1 A G 7: 107,571,149 Y81C probably damaging Het
Olfr735 A G 14: 50,346,415 V9A probably benign Het
Pcdhga7 A T 18: 37,716,173 N411I probably benign Het
Pcdhgb8 T C 18: 37,763,949 F691L probably benign Het
Pik3c2a A G 7: 116,391,282 V481A probably damaging Het
Pik3r6 A T 11: 68,533,875 R435S probably benign Het
Pkd1l1 G A 11: 8,849,013 H2250Y Het
Pkd1l1 A G 11: 8,909,857 S1034P Het
Plcd1 C A 9: 119,074,652 R400L possibly damaging Het
Ppp2r1a A G 17: 20,954,617 T58A probably benign Het
Ppp5c T C 7: 17,027,800 E5G possibly damaging Het
Pradc1 A C 6: 85,447,968 F82L probably benign Het
Prkag3 A T 1: 74,741,257 S416R probably benign Het
Rab3gap2 T C 1: 185,249,920 C390R probably benign Het
Rhot1 A G 11: 80,265,803 T655A probably benign Het
Rorc A G 3: 94,391,188 I348V probably damaging Het
Ryr1 A T 7: 29,097,224 V1051E probably benign Het
Sema5b GCAC GC 16: 35,658,256 probably null Het
Serpinb3c G A 1: 107,272,014 T259I probably damaging Het
Sh3gl1 A T 17: 56,019,438 M70K probably damaging Het
Slc7a4 C T 16: 17,573,366 V607I probably benign Het
Spop A T 11: 95,471,328 N62Y probably damaging Het
Spout1 A G 2: 30,176,811 F130S probably benign Het
Tab1 A G 15: 80,158,865 H420R possibly damaging Het
Tecpr2 CA C 12: 110,932,642 probably null Het
Tnxb G C 17: 34,714,603 K2332N probably damaging Het
Togaram1 T C 12: 64,967,738 Y588H probably damaging Het
Trim71 G A 9: 114,513,085 R710C probably damaging Het
Tsen54 C T 11: 115,820,782 Q342* probably null Het
Ube2r2 T A 4: 41,190,812 N235K unknown Het
Utrn C A 10: 12,667,527 K1792N possibly damaging Het
Vmn1r122 A G 7: 21,133,662 I156T possibly damaging Het
Vmn1r94 T C 7: 20,167,711 T223A possibly damaging Het
Vmn2r120 G A 17: 57,524,683 R369W probably damaging Het
Vwa7 G T 17: 35,024,433 A717S possibly damaging Het
Zc3h4 T A 7: 16,425,722 C398S unknown Het
Zc3hc1 T A 6: 30,390,875 E43V possibly damaging Het
Zfp101 A T 17: 33,381,537 V415D possibly damaging Het
Zfp553 A G 7: 127,236,596 H441R probably damaging Het
Other mutations in Adk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Adk APN 14 21092393 missense probably damaging 1.00
IGL01403:Adk APN 14 21234915 missense probably damaging 0.99
IGL01701:Adk APN 14 21103854 missense probably damaging 1.00
IGL02405:Adk APN 14 21103831 missense probably benign 0.06
IGL02808:Adk APN 14 21103833 missense probably benign 0.08
jeopardy UTSW 14 21234914 missense probably damaging 0.99
presumption UTSW 14 21240531 missense probably damaging 1.00
R0385:Adk UTSW 14 21318074 missense probably benign 0.01
R0463:Adk UTSW 14 21423536 missense probably benign 0.35
R0904:Adk UTSW 14 21092428 missense probably damaging 0.96
R1448:Adk UTSW 14 21052640 start codon destroyed probably null 0.00
R1695:Adk UTSW 14 21381600 missense probably benign 0.01
R2048:Adk UTSW 14 21318176 missense probably damaging 1.00
R4838:Adk UTSW 14 21369086 missense probably damaging 1.00
R5183:Adk UTSW 14 21240531 missense probably damaging 1.00
R5988:Adk UTSW 14 21423548 missense probably benign 0.03
R6770:Adk UTSW 14 21234914 missense probably damaging 0.99
R6932:Adk UTSW 14 21076308 start codon destroyed probably null 0.23
R7146:Adk UTSW 14 21326614 missense
R7257:Adk UTSW 14 21052671 missense probably damaging 0.99
R7491:Adk UTSW 14 21234929 missense probably damaging 0.96
R7806:Adk UTSW 14 21326611 missense
R8465:Adk UTSW 14 21103824 missense possibly damaging 0.80
R9709:Adk UTSW 14 21076318 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTGCCATTTCTCTGTGGAC -3'
(R):5'- CAGTGTTAGAGAAATGTACACTGAG -3'

Sequencing Primer
(F):5'- ACAAGCATTGGTATTTGAGTGAATC -3'
(R):5'- GGATCTCAACTCATAGAGGTCTGC -3'
Posted On 2020-09-15