Incidental Mutation 'R7922:Fzd6'
ID 648480
Institutional Source Beutler Lab
Gene Symbol Fzd6
Ensembl Gene ENSMUSG00000022297
Gene Name frizzled class receptor 6
Synonyms Fz6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7922 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 39006034-39038188 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 39031108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 223 (D223V)
Ref Sequence ENSEMBL: ENSMUSP00000022906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022906] [ENSMUST00000179165]
AlphaFold Q61089
Predicted Effect probably damaging
Transcript: ENSMUST00000022906
AA Change: D223V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022906
Gene: ENSMUSG00000022297
AA Change: D223V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FRI 23 134 9.66e-59 SMART
Frizzled 188 513 4.88e-184 SMART
low complexity region 532 543 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179165
AA Change: D223V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136328
Gene: ENSMUSG00000022297
AA Change: D223V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FRI 23 134 9.66e-59 SMART
Frizzled 188 513 4.88e-184 SMART
low complexity region 532 543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a member of the 'frizzled' gene family, which encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The protein encoded by this family member contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, and seven transmembrane domains, but unlike other family members, this protein does not contain a C-terminal PDZ domain-binding motif. This protein functions as a negative regulator of the canonical Wnt/beta-catenin signaling cascade, thereby inhibiting the processes that trigger oncogenic transformation, cell proliferation, and inhibition of apoptosis. Alternative splicing results in multiple transcript variants, some of which do not encode a protein with a predicted signal peptide.[provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mice for one mutation display abnormal hair follicle orientation. Another mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,164,406 T638M possibly damaging Het
4930546C10Rik A G 18: 68,949,996 probably null Het
Abi3 A T 11: 95,832,793 Y342N unknown Het
Adk G A 14: 21,318,043 V195I probably benign Het
Ago2 C T 15: 73,126,526 V268M possibly damaging Het
Apaf1 T C 10: 90,999,753 I1077V probably benign Het
Arap1 A T 7: 101,404,414 K1317* probably null Het
Auts2 T A 5: 131,440,373 D493V Het
Baz1b A T 5: 135,231,679 Q1110L probably damaging Het
Brsk2 T A 7: 141,993,220 S467T possibly damaging Het
Btbd9 A T 17: 30,274,884 M511K probably benign Het
Cdh23 T A 10: 60,382,706 Y1385F probably benign Het
Cfap100 A C 6: 90,403,980 L427V unknown Het
Cnga1 A G 5: 72,604,882 F430L possibly damaging Het
Dnhd1 A T 7: 105,668,514 D472V probably damaging Het
Dock2 T A 11: 34,707,327 E339V probably benign Het
Eif3a A T 19: 60,775,842 V379E probably damaging Het
Erich4 T A 7: 25,615,743 N36Y probably damaging Het
Fam60a T A 6: 148,926,146 T125S probably benign Het
Frem2 T C 3: 53,653,304 T1261A probably damaging Het
Gabra2 A T 5: 71,007,972 Y218* probably null Het
Gcn1l1 G T 5: 115,614,468 M2177I probably benign Het
Ghr G A 15: 3,341,074 T103I possibly damaging Het
Gipc1 T C 8: 83,661,228 V79A probably benign Het
Gm10031 A T 1: 156,524,992 L254F probably damaging Het
Gm13272 T A 4: 88,780,340 V164D probably damaging Het
Gramd4 C A 15: 86,131,958 H503Q probably benign Het
Gstm4 A T 3: 108,044,671 M1K probably null Het
Heatr5b T A 17: 78,760,559 Q1800L probably benign Het
Hectd1 T A 12: 51,790,195 K826* probably null Het
Hoxa9 T C 6: 52,224,309 I251V possibly damaging Het
Il2ra A T 2: 11,674,366 I46F possibly damaging Het
Ints2 T A 11: 86,244,627 R320S probably benign Het
Iscu A T 5: 113,774,282 N46I probably damaging Het
Iscu G A 5: 113,774,349 R60Q unknown Het
Kcnk3 A T 5: 30,588,531 H72L probably damaging Het
Kmt2a T G 9: 44,842,860 S1228R unknown Het
Mbl2 T A 19: 30,239,238 L150Q probably damaging Het
Med13 A T 11: 86,271,005 F2166Y probably damaging Het
Mterf4 A C 1: 93,301,553 L246* probably null Het
Muc16 T C 9: 18,584,825 Q6690R probably benign Het
Myh10 T A 11: 68,808,893 L1722Q possibly damaging Het
Neurod2 T C 11: 98,327,628 M237V probably benign Het
Olfml1 A G 7: 107,571,149 Y81C probably damaging Het
Olfr735 A G 14: 50,346,415 V9A probably benign Het
Pcdhga7 A T 18: 37,716,173 N411I probably benign Het
Pcdhgb8 T C 18: 37,763,949 F691L probably benign Het
Pik3c2a A G 7: 116,391,282 V481A probably damaging Het
Pik3r6 A T 11: 68,533,875 R435S probably benign Het
Pkd1l1 G A 11: 8,849,013 H2250Y Het
Pkd1l1 A G 11: 8,909,857 S1034P Het
Plcd1 C A 9: 119,074,652 R400L possibly damaging Het
Ppp2r1a A G 17: 20,954,617 T58A probably benign Het
Ppp5c T C 7: 17,027,800 E5G possibly damaging Het
Pradc1 A C 6: 85,447,968 F82L probably benign Het
Prkag3 A T 1: 74,741,257 S416R probably benign Het
Rab3gap2 T C 1: 185,249,920 C390R probably benign Het
Rhot1 A G 11: 80,265,803 T655A probably benign Het
Rorc A G 3: 94,391,188 I348V probably damaging Het
Ryr1 A T 7: 29,097,224 V1051E probably benign Het
Sema5b GCAC GC 16: 35,658,256 probably null Het
Serpinb3c G A 1: 107,272,014 T259I probably damaging Het
Sh3gl1 A T 17: 56,019,438 M70K probably damaging Het
Slc7a4 C T 16: 17,573,366 V607I probably benign Het
Spop A T 11: 95,471,328 N62Y probably damaging Het
Spout1 A G 2: 30,176,811 F130S probably benign Het
Tab1 A G 15: 80,158,865 H420R possibly damaging Het
Tecpr2 CA C 12: 110,932,642 probably null Het
Tnxb G C 17: 34,714,603 K2332N probably damaging Het
Togaram1 T C 12: 64,967,738 Y588H probably damaging Het
Trim71 G A 9: 114,513,085 R710C probably damaging Het
Tsen54 C T 11: 115,820,782 Q342* probably null Het
Ube2r2 T A 4: 41,190,812 N235K unknown Het
Utrn C A 10: 12,667,527 K1792N possibly damaging Het
Vmn1r122 A G 7: 21,133,662 I156T possibly damaging Het
Vmn1r94 T C 7: 20,167,711 T223A possibly damaging Het
Vmn2r120 G A 17: 57,524,683 R369W probably damaging Het
Vwa7 G T 17: 35,024,433 A717S possibly damaging Het
Zc3h4 T A 7: 16,425,722 C398S unknown Het
Zc3hc1 T A 6: 30,390,875 E43V possibly damaging Het
Zfp101 A T 17: 33,381,537 V415D possibly damaging Het
Zfp553 A G 7: 127,236,596 H441R probably damaging Het
Other mutations in Fzd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02470:Fzd6 APN 15 39036557 utr 3 prime probably benign
IGL02500:Fzd6 APN 15 39031386 missense probably damaging 1.00
IGL02938:Fzd6 APN 15 39033890 missense probably benign 0.03
IGL03219:Fzd6 APN 15 39031576 missense probably damaging 1.00
R0314:Fzd6 UTSW 15 39025733 missense possibly damaging 0.88
R0458:Fzd6 UTSW 15 39031281 missense probably damaging 1.00
R0478:Fzd6 UTSW 15 39034034 splice site probably null
R0961:Fzd6 UTSW 15 39025678 missense probably damaging 1.00
R1473:Fzd6 UTSW 15 39030963 missense probably damaging 1.00
R1479:Fzd6 UTSW 15 39030999 missense probably damaging 1.00
R1533:Fzd6 UTSW 15 39031624 missense probably damaging 1.00
R1731:Fzd6 UTSW 15 39031327 missense probably damaging 1.00
R1836:Fzd6 UTSW 15 39033920 missense probably damaging 1.00
R2241:Fzd6 UTSW 15 39031536 missense probably damaging 0.96
R5089:Fzd6 UTSW 15 39007480 missense probably damaging 1.00
R5526:Fzd6 UTSW 15 39031164 missense possibly damaging 0.89
R5666:Fzd6 UTSW 15 39031115 missense probably benign 0.32
R5670:Fzd6 UTSW 15 39031115 missense probably benign 0.32
R5903:Fzd6 UTSW 15 39007388 start codon destroyed probably null 0.99
R6221:Fzd6 UTSW 15 39030844 missense probably benign 0.00
R6944:Fzd6 UTSW 15 39025817 missense possibly damaging 0.69
R7731:Fzd6 UTSW 15 39033932 missense probably damaging 1.00
R8195:Fzd6 UTSW 15 39031564 missense probably damaging 1.00
R8985:Fzd6 UTSW 15 39031624 missense probably damaging 1.00
R9196:Fzd6 UTSW 15 39031707 missense probably damaging 1.00
R9196:Fzd6 UTSW 15 39031708 missense probably damaging 1.00
R9212:Fzd6 UTSW 15 39034894 missense probably damaging 0.97
R9276:Fzd6 UTSW 15 39007567 splice site probably benign
R9350:Fzd6 UTSW 15 39031648 missense probably damaging 1.00
R9384:Fzd6 UTSW 15 39031707 missense probably damaging 1.00
R9384:Fzd6 UTSW 15 39031708 missense probably damaging 1.00
R9650:Fzd6 UTSW 15 39031546 missense probably damaging 1.00
Z1177:Fzd6 UTSW 15 39007561 missense possibly damaging 0.72
Z1177:Fzd6 UTSW 15 39031341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACACAGAGCTTTCTGGG -3'
(R):5'- TCTTTGACCCTAGGACAACGG -3'

Sequencing Primer
(F):5'- TGGTGTCCAAAGCACCTTAG -3'
(R):5'- GTGTCCCCGAGCTCCAG -3'
Posted On 2020-09-15