Incidental Mutation 'R7922:Ago2'
ID 648481
Institutional Source Beutler Lab
Gene Symbol Ago2
Ensembl Gene ENSMUSG00000036698
Gene Name argonaute RISC catalytic subunit 2
Synonyms 2310051F07Rik, argonaute 2, Eif2c2, 1110029L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7922 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 73095844-73184935 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 73126526 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 268 (V268M)
Ref Sequence ENSEMBL: ENSMUSP00000042207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044113]
AlphaFold Q8CJG0
Predicted Effect possibly damaging
Transcript: ENSMUST00000044113
AA Change: V268M

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042207
Gene: ENSMUSG00000036698
AA Change: V268M

DomainStartEndE-ValueType
Pfam:ArgoN 29 167 1.7e-29 PFAM
DUF1785 176 228 2.98e-24 SMART
PAZ 236 371 3.11e-4 SMART
Pfam:ArgoL2 376 421 8.7e-16 PFAM
Pfam:ArgoMid 430 512 2.9e-35 PFAM
Piwi 518 819 1.36e-135 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, and contains a PAZ domain and a PIWI domain. It may interact with dicer1 and play a role in short-interfering-RNA-mediated gene silencing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality with neural tube defects, abnormal forebrain patterning, enlarged hearts, pericardial swelling, delayed development, and defects in the yolk sac and placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,164,406 T638M possibly damaging Het
4930546C10Rik A G 18: 68,949,996 probably null Het
Abi3 A T 11: 95,832,793 Y342N unknown Het
Adk G A 14: 21,318,043 V195I probably benign Het
Apaf1 T C 10: 90,999,753 I1077V probably benign Het
Arap1 A T 7: 101,404,414 K1317* probably null Het
Auts2 T A 5: 131,440,373 D493V Het
Baz1b A T 5: 135,231,679 Q1110L probably damaging Het
Brsk2 T A 7: 141,993,220 S467T possibly damaging Het
Btbd9 A T 17: 30,274,884 M511K probably benign Het
Cdh23 T A 10: 60,382,706 Y1385F probably benign Het
Cfap100 A C 6: 90,403,980 L427V unknown Het
Cnga1 A G 5: 72,604,882 F430L possibly damaging Het
Dnhd1 A T 7: 105,668,514 D472V probably damaging Het
Dock2 T A 11: 34,707,327 E339V probably benign Het
Eif3a A T 19: 60,775,842 V379E probably damaging Het
Erich4 T A 7: 25,615,743 N36Y probably damaging Het
Fam60a T A 6: 148,926,146 T125S probably benign Het
Frem2 T C 3: 53,653,304 T1261A probably damaging Het
Fzd6 A T 15: 39,031,108 D223V probably damaging Het
Gabra2 A T 5: 71,007,972 Y218* probably null Het
Gcn1l1 G T 5: 115,614,468 M2177I probably benign Het
Ghr G A 15: 3,341,074 T103I possibly damaging Het
Gipc1 T C 8: 83,661,228 V79A probably benign Het
Gm10031 A T 1: 156,524,992 L254F probably damaging Het
Gm13272 T A 4: 88,780,340 V164D probably damaging Het
Gramd4 C A 15: 86,131,958 H503Q probably benign Het
Gstm4 A T 3: 108,044,671 M1K probably null Het
Heatr5b T A 17: 78,760,559 Q1800L probably benign Het
Hectd1 T A 12: 51,790,195 K826* probably null Het
Hoxa9 T C 6: 52,224,309 I251V possibly damaging Het
Il2ra A T 2: 11,674,366 I46F possibly damaging Het
Ints2 T A 11: 86,244,627 R320S probably benign Het
Iscu A T 5: 113,774,282 N46I probably damaging Het
Iscu G A 5: 113,774,349 R60Q unknown Het
Kcnk3 A T 5: 30,588,531 H72L probably damaging Het
Kmt2a T G 9: 44,842,860 S1228R unknown Het
Mbl2 T A 19: 30,239,238 L150Q probably damaging Het
Med13 A T 11: 86,271,005 F2166Y probably damaging Het
Mterf4 A C 1: 93,301,553 L246* probably null Het
Muc16 T C 9: 18,584,825 Q6690R probably benign Het
Myh10 T A 11: 68,808,893 L1722Q possibly damaging Het
Neurod2 T C 11: 98,327,628 M237V probably benign Het
Olfml1 A G 7: 107,571,149 Y81C probably damaging Het
Olfr735 A G 14: 50,346,415 V9A probably benign Het
Pcdhga7 A T 18: 37,716,173 N411I probably benign Het
Pcdhgb8 T C 18: 37,763,949 F691L probably benign Het
Pik3c2a A G 7: 116,391,282 V481A probably damaging Het
Pik3r6 A T 11: 68,533,875 R435S probably benign Het
Pkd1l1 G A 11: 8,849,013 H2250Y Het
Pkd1l1 A G 11: 8,909,857 S1034P Het
Plcd1 C A 9: 119,074,652 R400L possibly damaging Het
Ppp2r1a A G 17: 20,954,617 T58A probably benign Het
Ppp5c T C 7: 17,027,800 E5G possibly damaging Het
Pradc1 A C 6: 85,447,968 F82L probably benign Het
Prkag3 A T 1: 74,741,257 S416R probably benign Het
Rab3gap2 T C 1: 185,249,920 C390R probably benign Het
Rhot1 A G 11: 80,265,803 T655A probably benign Het
Rorc A G 3: 94,391,188 I348V probably damaging Het
Ryr1 A T 7: 29,097,224 V1051E probably benign Het
Sema5b GCAC GC 16: 35,658,256 probably null Het
Serpinb3c G A 1: 107,272,014 T259I probably damaging Het
Sh3gl1 A T 17: 56,019,438 M70K probably damaging Het
Slc7a4 C T 16: 17,573,366 V607I probably benign Het
Spop A T 11: 95,471,328 N62Y probably damaging Het
Spout1 A G 2: 30,176,811 F130S probably benign Het
Tab1 A G 15: 80,158,865 H420R possibly damaging Het
Tecpr2 CA C 12: 110,932,642 probably null Het
Tnxb G C 17: 34,714,603 K2332N probably damaging Het
Togaram1 T C 12: 64,967,738 Y588H probably damaging Het
Trim71 G A 9: 114,513,085 R710C probably damaging Het
Tsen54 C T 11: 115,820,782 Q342* probably null Het
Ube2r2 T A 4: 41,190,812 N235K unknown Het
Utrn C A 10: 12,667,527 K1792N possibly damaging Het
Vmn1r122 A G 7: 21,133,662 I156T possibly damaging Het
Vmn1r94 T C 7: 20,167,711 T223A possibly damaging Het
Vmn2r120 G A 17: 57,524,683 R369W probably damaging Het
Vwa7 G T 17: 35,024,433 A717S possibly damaging Het
Zc3h4 T A 7: 16,425,722 C398S unknown Het
Zc3hc1 T A 6: 30,390,875 E43V possibly damaging Het
Zfp101 A T 17: 33,381,537 V415D possibly damaging Het
Zfp553 A G 7: 127,236,596 H441R probably damaging Het
Other mutations in Ago2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ago2 APN 15 73126453 missense probably benign 0.00
IGL01642:Ago2 APN 15 73123390 missense probably benign 0.00
IGL02017:Ago2 APN 15 73126517 missense probably benign 0.15
IGL02246:Ago2 APN 15 73108418 missense probably damaging 1.00
IGL02434:Ago2 APN 15 73121081 missense probably damaging 1.00
IGL02674:Ago2 APN 15 73111794 missense probably damaging 1.00
IGL02686:Ago2 APN 15 73113742 missense possibly damaging 0.95
IGL02716:Ago2 APN 15 73111727 missense possibly damaging 0.94
IGL02751:Ago2 APN 15 73130897 missense possibly damaging 0.76
IGL02973:Ago2 APN 15 73123465 splice site probably benign
IGL03188:Ago2 APN 15 73123333 missense probably benign
PIT4791001:Ago2 UTSW 15 73121240 missense possibly damaging 0.72
R0316:Ago2 UTSW 15 73130876 missense probably damaging 0.99
R1382:Ago2 UTSW 15 73127040 missense probably benign 0.35
R1509:Ago2 UTSW 15 73116364 missense probably damaging 1.00
R1802:Ago2 UTSW 15 73121180 missense probably damaging 1.00
R1848:Ago2 UTSW 15 73123965 missense probably benign 0.02
R1930:Ago2 UTSW 15 73119355 missense probably damaging 0.97
R2195:Ago2 UTSW 15 73119469 missense probably benign 0.15
R2219:Ago2 UTSW 15 73146411 missense probably benign
R2350:Ago2 UTSW 15 73119461 missense probably benign 0.01
R2517:Ago2 UTSW 15 73124242 missense possibly damaging 0.76
R3727:Ago2 UTSW 15 73113857 missense probably damaging 1.00
R4614:Ago2 UTSW 15 73130967 missense probably damaging 0.98
R4667:Ago2 UTSW 15 73146416 missense probably damaging 1.00
R5101:Ago2 UTSW 15 73119490 missense probably damaging 0.99
R5175:Ago2 UTSW 15 73124218 missense possibly damaging 0.57
R5751:Ago2 UTSW 15 73128323 critical splice donor site probably null
R5815:Ago2 UTSW 15 73107366 critical splice acceptor site probably null
R6166:Ago2 UTSW 15 73124240 missense probably benign 0.00
R6378:Ago2 UTSW 15 73123925 missense probably benign
R6572:Ago2 UTSW 15 73126977 missense probably benign 0.14
R6922:Ago2 UTSW 15 73113752 missense probably benign 0.39
R7068:Ago2 UTSW 15 73146450 missense probably damaging 1.00
R7447:Ago2 UTSW 15 73138032 missense probably benign 0.35
R7449:Ago2 UTSW 15 73146499 missense probably damaging 1.00
R8183:Ago2 UTSW 15 73119488 nonsense probably null
R8271:Ago2 UTSW 15 73119466 missense probably damaging 1.00
R8351:Ago2 UTSW 15 73130890 missense probably damaging 1.00
R8451:Ago2 UTSW 15 73130890 missense probably damaging 1.00
R9286:Ago2 UTSW 15 73125216 missense probably damaging 1.00
R9726:Ago2 UTSW 15 73127070 missense probably damaging 1.00
X0012:Ago2 UTSW 15 73106952 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CAGCTGTTTGCAGGACAGTC -3'
(R):5'- CACCCAAGTCTTAAGTGCTGAG -3'

Sequencing Primer
(F):5'- TGTTTGCAGGACAGTCCCAGG -3'
(R):5'- TATTCTGGCAGAGGGCTTCCC -3'
Posted On 2020-09-15