Incidental Mutation 'R7922:Sema5b'
ID648485
Institutional Source Beutler Lab
Gene Symbol Sema5b
Ensembl Gene ENSMUSG00000052133
Gene Namesema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B
SynonymsSemG, Semag, SemG
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7922 (G1)
Quality Score217.468
Status Not validated
Chromosome16
Chromosomal Location35541145-35664732 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCAC to GC at 35658256 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050625] [ENSMUST00000120756]
Predicted Effect probably null
Transcript: ENSMUST00000050625
SMART Domains Protein: ENSMUSP00000057494
Gene: ENSMUSG00000052133

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Sema 68 479 1.68e-174 SMART
PSI 497 544 9.18e-12 SMART
TSP1 609 662 3.34e-15 SMART
TSP1 667 713 3.42e-12 SMART
TSP1 798 850 1.58e-16 SMART
TSP1 855 907 2.45e-13 SMART
TSP1 910 957 1.02e-1 SMART
transmembrane domain 977 999 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120756
SMART Domains Protein: ENSMUSP00000112536
Gene: ENSMUSG00000052133

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Sema 68 479 1.68e-174 SMART
PSI 497 544 9.18e-12 SMART
TSP1 609 662 3.34e-15 SMART
TSP1 667 742 7.61e-10 SMART
TSP1 827 879 1.58e-16 SMART
TSP1 884 936 2.45e-13 SMART
TSP1 939 986 1.02e-1 SMART
transmembrane domain 1006 1028 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin protein family which regulates axon growth during development of the nervous system. The encoded protein has a characteristic Sema domain near the N-terminus, through which semaphorins bind to plexin, and five thrombospondin type 1 repeats in the C-terminal region of the protein. The protein product may be cleaved and exist as a secreted molecule (PMID: 19463192). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display defects in neurite arborization of multiple retinal cell types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,164,406 T638M possibly damaging Het
4930546C10Rik A G 18: 68,949,996 probably null Het
Abi3 A T 11: 95,832,793 Y342N unknown Het
Adk G A 14: 21,318,043 V195I probably benign Het
Ago2 C T 15: 73,126,526 V268M possibly damaging Het
Apaf1 T C 10: 90,999,753 I1077V probably benign Het
Arap1 A T 7: 101,404,414 K1317* probably null Het
Auts2 T A 5: 131,440,373 D493V Het
Baz1b A T 5: 135,231,679 Q1110L probably damaging Het
Brsk2 T A 7: 141,993,220 S467T possibly damaging Het
Btbd9 A T 17: 30,274,884 M511K probably benign Het
Cdh23 T A 10: 60,382,706 Y1385F probably benign Het
Cfap100 A C 6: 90,403,980 L427V unknown Het
Cnga1 A G 5: 72,604,882 F430L possibly damaging Het
Dnhd1 A T 7: 105,668,514 D472V probably damaging Het
Dock2 T A 11: 34,707,327 E339V probably benign Het
Eif3a A T 19: 60,775,842 V379E probably damaging Het
Erich4 T A 7: 25,615,743 N36Y probably damaging Het
Fam60a T A 6: 148,926,146 T125S probably benign Het
Frem2 T C 3: 53,653,304 T1261A probably damaging Het
Fzd6 A T 15: 39,031,108 D223V probably damaging Het
Gabra2 A T 5: 71,007,972 Y218* probably null Het
Gcn1l1 G T 5: 115,614,468 M2177I probably benign Het
Ghr G A 15: 3,341,074 T103I possibly damaging Het
Gipc1 T C 8: 83,661,228 V79A probably benign Het
Gm10031 A T 1: 156,524,992 L254F probably damaging Het
Gm13272 T A 4: 88,780,340 V164D probably damaging Het
Gramd4 C A 15: 86,131,958 H503Q probably benign Het
Gstm4 A T 3: 108,044,671 M1K probably null Het
Heatr5b T A 17: 78,760,559 Q1800L probably benign Het
Hectd1 T A 12: 51,790,195 K826* probably null Het
Hoxa9 T C 6: 52,224,309 I251V possibly damaging Het
Il2ra A T 2: 11,674,366 I46F possibly damaging Het
Ints2 T A 11: 86,244,627 R320S probably benign Het
Iscu A T 5: 113,774,282 N46I probably damaging Het
Iscu G A 5: 113,774,349 R60Q unknown Het
Kcnk3 A T 5: 30,588,531 H72L probably damaging Het
Kmt2a T G 9: 44,842,860 S1228R unknown Het
Mbl2 T A 19: 30,239,238 L150Q probably damaging Het
Med13 A T 11: 86,271,005 F2166Y probably damaging Het
Mterf4 A C 1: 93,301,553 L246* probably null Het
Muc16 T C 9: 18,584,825 Q6690R probably benign Het
Myh10 T A 11: 68,808,893 L1722Q possibly damaging Het
Neurod2 T C 11: 98,327,628 M237V probably benign Het
Olfml1 A G 7: 107,571,149 Y81C probably damaging Het
Olfr735 A G 14: 50,346,415 V9A probably benign Het
Pcdhga7 A T 18: 37,716,173 N411I probably benign Het
Pcdhgb8 T C 18: 37,763,949 F691L probably benign Het
Pik3c2a A G 7: 116,391,282 V481A probably damaging Het
Pik3r6 A T 11: 68,533,875 R435S probably benign Het
Pkd1l1 G A 11: 8,849,013 H2250Y Het
Pkd1l1 A G 11: 8,909,857 S1034P Het
Plcd1 C A 9: 119,074,652 R400L possibly damaging Het
Ppp2r1a A G 17: 20,954,617 T58A probably benign Het
Ppp5c T C 7: 17,027,800 E5G possibly damaging Het
Pradc1 A C 6: 85,447,968 F82L probably benign Het
Prkag3 A T 1: 74,741,257 S416R probably benign Het
Rab3gap2 T C 1: 185,249,920 C390R probably benign Het
Rhot1 A G 11: 80,265,803 T655A probably benign Het
Rorc A G 3: 94,391,188 I348V probably damaging Het
Ryr1 A T 7: 29,097,224 V1051E probably benign Het
Serpinb3c G A 1: 107,272,014 T259I probably damaging Het
Sh3gl1 A T 17: 56,019,438 M70K probably damaging Het
Slc7a4 C T 16: 17,573,366 V607I probably benign Het
Spop A T 11: 95,471,328 N62Y probably damaging Het
Spout1 A G 2: 30,176,811 F130S probably benign Het
Tab1 A G 15: 80,158,865 H420R possibly damaging Het
Tecpr2 CA C 12: 110,932,642 probably null Het
Tnxb G C 17: 34,714,603 K2332N probably damaging Het
Togaram1 T C 12: 64,967,738 Y588H probably damaging Het
Trim71 G A 9: 114,513,085 R710C probably damaging Het
Tsen54 C T 11: 115,820,782 Q342* probably null Het
Ube2r2 T A 4: 41,190,812 N235K unknown Het
Utrn C A 10: 12,667,527 K1792N possibly damaging Het
Vmn1r122 A G 7: 21,133,662 I156T possibly damaging Het
Vmn1r94 T C 7: 20,167,711 T223A possibly damaging Het
Vmn2r120 G A 17: 57,524,683 R369W probably damaging Het
Vwa7 G T 17: 35,024,433 A717S possibly damaging Het
Zc3h4 T A 7: 16,425,722 C398S unknown Het
Zc3hc1 T A 6: 30,390,875 E43V possibly damaging Het
Zfp101 A T 17: 33,381,537 V415D possibly damaging Het
Zfp553 A G 7: 127,236,596 H441R probably damaging Het
Other mutations in Sema5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Sema5b APN 16 35651315 missense probably damaging 1.00
IGL01584:Sema5b APN 16 35645423 missense probably damaging 1.00
IGL01859:Sema5b APN 16 35647109 missense possibly damaging 0.94
IGL02195:Sema5b APN 16 35660479 critical splice acceptor site probably null
IGL02346:Sema5b APN 16 35649755 missense probably damaging 1.00
IGL02850:Sema5b APN 16 35660515 missense probably benign 0.01
IGL03277:Sema5b APN 16 35651312 missense probably damaging 0.96
R0101:Sema5b UTSW 16 35663102 splice site probably benign
R0368:Sema5b UTSW 16 35628100 missense probably damaging 1.00
R0426:Sema5b UTSW 16 35646355 missense probably damaging 1.00
R0675:Sema5b UTSW 16 35660333 missense probably benign 0.00
R0905:Sema5b UTSW 16 35622631 missense probably benign 0.33
R1163:Sema5b UTSW 16 35628096 missense probably benign 0.19
R1195:Sema5b UTSW 16 35651660 missense probably null 0.94
R1195:Sema5b UTSW 16 35651660 missense probably null 0.94
R1666:Sema5b UTSW 16 35658482 missense probably benign 0.03
R1706:Sema5b UTSW 16 35649755 missense probably damaging 0.98
R1733:Sema5b UTSW 16 35646367 missense probably damaging 1.00
R1775:Sema5b UTSW 16 35660324 missense probably benign
R2215:Sema5b UTSW 16 35660215 missense probably damaging 1.00
R2844:Sema5b UTSW 16 35659931 missense probably damaging 0.98
R3086:Sema5b UTSW 16 35622723 missense probably benign
R3613:Sema5b UTSW 16 35660150 missense probably benign
R4774:Sema5b UTSW 16 35663182 missense probably damaging 1.00
R5743:Sema5b UTSW 16 35658476 missense probably damaging 1.00
R5856:Sema5b UTSW 16 35646386 nonsense probably null
R5993:Sema5b UTSW 16 35646202 missense probably damaging 1.00
R6248:Sema5b UTSW 16 35628007 splice site probably null
R6420:Sema5b UTSW 16 35663146 missense probably benign 0.08
R6795:Sema5b UTSW 16 35658571 nonsense probably null
R6825:Sema5b UTSW 16 35628007 splice site probably null
R7066:Sema5b UTSW 16 35651312 missense probably benign 0.26
R7244:Sema5b UTSW 16 35660545 missense probably benign
R7446:Sema5b UTSW 16 35647203 missense probably damaging 1.00
R7497:Sema5b UTSW 16 35661330 missense probably damaging 1.00
R7516:Sema5b UTSW 16 35651170 missense probably benign 0.05
R7878:Sema5b UTSW 16 35661626 missense probably benign 0.00
R8397:Sema5b UTSW 16 35651321 missense possibly damaging 0.59
R8537:Sema5b UTSW 16 35651609 missense possibly damaging 0.49
Z1088:Sema5b UTSW 16 35660590 missense probably damaging 0.99
Z1176:Sema5b UTSW 16 35628018 missense probably benign 0.01
Z1176:Sema5b UTSW 16 35646273 missense probably benign 0.05
Z1176:Sema5b UTSW 16 35649864 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGCATAGAAAGAGGTGCC -3'
(R):5'- TCACACGGTTTCCATGGTGAC -3'

Sequencing Primer
(F):5'- CCACAGTGGGGTTGTCCAG -3'
(R):5'- TCGTACCTGCAGACTCATATAAGGG -3'
Posted On2020-09-15