Incidental Mutation 'R7922:Sema5b'
ID 648485
Institutional Source Beutler Lab
Gene Symbol Sema5b
Ensembl Gene ENSMUSG00000052133
Gene Name sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B
Synonyms SemG, SemG, Semag
MMRRC Submission 045969-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7922 (G1)
Quality Score 217.468
Status Not validated
Chromosome 16
Chromosomal Location 35361517-35485103 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GCAC to GC at 35478626 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050625] [ENSMUST00000120756]
AlphaFold Q60519
Predicted Effect probably null
Transcript: ENSMUST00000050625
SMART Domains Protein: ENSMUSP00000057494
Gene: ENSMUSG00000052133

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Sema 68 479 1.68e-174 SMART
PSI 497 544 9.18e-12 SMART
TSP1 609 662 3.34e-15 SMART
TSP1 667 713 3.42e-12 SMART
TSP1 798 850 1.58e-16 SMART
TSP1 855 907 2.45e-13 SMART
TSP1 910 957 1.02e-1 SMART
transmembrane domain 977 999 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120756
SMART Domains Protein: ENSMUSP00000112536
Gene: ENSMUSG00000052133

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Sema 68 479 1.68e-174 SMART
PSI 497 544 9.18e-12 SMART
TSP1 609 662 3.34e-15 SMART
TSP1 667 742 7.61e-10 SMART
TSP1 827 879 1.58e-16 SMART
TSP1 884 936 2.45e-13 SMART
TSP1 939 986 1.02e-1 SMART
transmembrane domain 1006 1028 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin protein family which regulates axon growth during development of the nervous system. The encoded protein has a characteristic Sema domain near the N-terminus, through which semaphorins bind to plexin, and five thrombospondin type 1 repeats in the C-terminal region of the protein. The protein product may be cleaved and exist as a secreted molecule (PMID: 19463192). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display defects in neurite arborization of multiple retinal cell types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,211,180 (GRCm39) T638M possibly damaging Het
4930546C10Rik A G 18: 69,083,067 (GRCm39) probably null Het
Abi3 A T 11: 95,723,619 (GRCm39) Y342N unknown Het
Adk G A 14: 21,368,111 (GRCm39) V195I probably benign Het
Ago2 C T 15: 72,998,375 (GRCm39) V268M possibly damaging Het
Apaf1 T C 10: 90,835,615 (GRCm39) I1077V probably benign Het
Arap1 A T 7: 101,053,621 (GRCm39) K1317* probably null Het
Auts2 T A 5: 131,469,211 (GRCm39) D493V Het
Baz1b A T 5: 135,260,533 (GRCm39) Q1110L probably damaging Het
Brsk2 T A 7: 141,546,957 (GRCm39) S467T possibly damaging Het
Btbd9 A T 17: 30,493,858 (GRCm39) M511K probably benign Het
Cdh23 T A 10: 60,218,485 (GRCm39) Y1385F probably benign Het
Cfap100 A C 6: 90,380,962 (GRCm39) L427V unknown Het
Cnga1 A G 5: 72,762,225 (GRCm39) F430L possibly damaging Het
Csnk2a1-ps3 A T 1: 156,352,562 (GRCm39) L254F probably damaging Het
Dnhd1 A T 7: 105,317,721 (GRCm39) D472V probably damaging Het
Dock2 T A 11: 34,598,154 (GRCm39) E339V probably benign Het
Eif3a A T 19: 60,764,280 (GRCm39) V379E probably damaging Het
Erich4 T A 7: 25,315,168 (GRCm39) N36Y probably damaging Het
Frem2 T C 3: 53,560,725 (GRCm39) T1261A probably damaging Het
Fzd6 A T 15: 38,894,503 (GRCm39) D223V probably damaging Het
Gabra2 A T 5: 71,165,315 (GRCm39) Y218* probably null Het
Gcn1 G T 5: 115,752,527 (GRCm39) M2177I probably benign Het
Ghr G A 15: 3,370,556 (GRCm39) T103I possibly damaging Het
Gipc1 T C 8: 84,387,857 (GRCm39) V79A probably benign Het
Gm13272 T A 4: 88,698,577 (GRCm39) V164D probably damaging Het
Gramd4 C A 15: 86,016,159 (GRCm39) H503Q probably benign Het
Gstm4 A T 3: 107,951,987 (GRCm39) M1K probably null Het
Heatr5b T A 17: 79,067,988 (GRCm39) Q1800L probably benign Het
Hectd1 T A 12: 51,836,978 (GRCm39) K826* probably null Het
Hoxa9 T C 6: 52,201,289 (GRCm39) I251V possibly damaging Het
Il2ra A T 2: 11,679,177 (GRCm39) I46F possibly damaging Het
Ints2 T A 11: 86,135,453 (GRCm39) R320S probably benign Het
Iscu A T 5: 113,912,343 (GRCm39) N46I probably damaging Het
Iscu G A 5: 113,912,410 (GRCm39) R60Q unknown Het
Kcnk3 A T 5: 30,745,875 (GRCm39) H72L probably damaging Het
Kmt2a T G 9: 44,754,157 (GRCm39) S1228R unknown Het
Mbl2 T A 19: 30,216,638 (GRCm39) L150Q probably damaging Het
Med13 A T 11: 86,161,831 (GRCm39) F2166Y probably damaging Het
Mterf4 A C 1: 93,229,275 (GRCm39) L246* probably null Het
Muc16 T C 9: 18,496,121 (GRCm39) Q6690R probably benign Het
Myh10 T A 11: 68,699,719 (GRCm39) L1722Q possibly damaging Het
Neurod2 T C 11: 98,218,454 (GRCm39) M237V probably benign Het
Olfml1 A G 7: 107,170,356 (GRCm39) Y81C probably damaging Het
Or4q3 A G 14: 50,583,872 (GRCm39) V9A probably benign Het
Pcdhga7 A T 18: 37,849,226 (GRCm39) N411I probably benign Het
Pcdhgb8 T C 18: 37,897,002 (GRCm39) F691L probably benign Het
Pik3c2a A G 7: 115,990,517 (GRCm39) V481A probably damaging Het
Pik3r6 A T 11: 68,424,701 (GRCm39) R435S probably benign Het
Pkd1l1 G A 11: 8,799,013 (GRCm39) H2250Y Het
Pkd1l1 A G 11: 8,859,857 (GRCm39) S1034P Het
Plcd1 C A 9: 118,903,720 (GRCm39) R400L possibly damaging Het
Ppp2r1a A G 17: 21,174,879 (GRCm39) T58A probably benign Het
Ppp5c T C 7: 16,761,725 (GRCm39) E5G possibly damaging Het
Pradc1 A C 6: 85,424,950 (GRCm39) F82L probably benign Het
Prkag3 A T 1: 74,780,416 (GRCm39) S416R probably benign Het
Rab3gap2 T C 1: 184,982,117 (GRCm39) C390R probably benign Het
Rhot1 A G 11: 80,156,629 (GRCm39) T655A probably benign Het
Rorc A G 3: 94,298,495 (GRCm39) I348V probably damaging Het
Ryr1 A T 7: 28,796,649 (GRCm39) V1051E probably benign Het
Serpinb3c G A 1: 107,199,744 (GRCm39) T259I probably damaging Het
Sh3gl1 A T 17: 56,326,438 (GRCm39) M70K probably damaging Het
Sinhcaf T A 6: 148,827,644 (GRCm39) T125S probably benign Het
Slc7a4 C T 16: 17,391,230 (GRCm39) V607I probably benign Het
Spop A T 11: 95,362,154 (GRCm39) N62Y probably damaging Het
Spout1 A G 2: 30,066,823 (GRCm39) F130S probably benign Het
Tab1 A G 15: 80,043,066 (GRCm39) H420R possibly damaging Het
Tecpr2 CA C 12: 110,899,076 (GRCm39) probably null Het
Tnxb G C 17: 34,933,577 (GRCm39) K2332N probably damaging Het
Togaram1 T C 12: 65,014,512 (GRCm39) Y588H probably damaging Het
Trim71 G A 9: 114,342,153 (GRCm39) R710C probably damaging Het
Tsen54 C T 11: 115,711,608 (GRCm39) Q342* probably null Het
Ube2r2 T A 4: 41,190,812 (GRCm39) N235K unknown Het
Utrn C A 10: 12,543,271 (GRCm39) K1792N possibly damaging Het
Vmn1r122 A G 7: 20,867,587 (GRCm39) I156T possibly damaging Het
Vmn1r94 T C 7: 19,901,636 (GRCm39) T223A possibly damaging Het
Vmn2r120 G A 17: 57,831,683 (GRCm39) R369W probably damaging Het
Vwa7 G T 17: 35,243,409 (GRCm39) A717S possibly damaging Het
Zc3h4 T A 7: 16,159,647 (GRCm39) C398S unknown Het
Zc3hc1 T A 6: 30,390,874 (GRCm39) E43V possibly damaging Het
Zfp101 A T 17: 33,600,511 (GRCm39) V415D possibly damaging Het
Zfp553 A G 7: 126,835,768 (GRCm39) H441R probably damaging Het
Other mutations in Sema5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Sema5b APN 16 35,471,685 (GRCm39) missense probably damaging 1.00
IGL01584:Sema5b APN 16 35,465,793 (GRCm39) missense probably damaging 1.00
IGL01859:Sema5b APN 16 35,467,479 (GRCm39) missense possibly damaging 0.94
IGL02195:Sema5b APN 16 35,480,849 (GRCm39) critical splice acceptor site probably null
IGL02346:Sema5b APN 16 35,470,125 (GRCm39) missense probably damaging 1.00
IGL02850:Sema5b APN 16 35,480,885 (GRCm39) missense probably benign 0.01
IGL03277:Sema5b APN 16 35,471,682 (GRCm39) missense probably damaging 0.96
R0101:Sema5b UTSW 16 35,483,472 (GRCm39) splice site probably benign
R0368:Sema5b UTSW 16 35,448,470 (GRCm39) missense probably damaging 1.00
R0426:Sema5b UTSW 16 35,466,725 (GRCm39) missense probably damaging 1.00
R0675:Sema5b UTSW 16 35,480,703 (GRCm39) missense probably benign 0.00
R0905:Sema5b UTSW 16 35,443,001 (GRCm39) missense probably benign 0.33
R1163:Sema5b UTSW 16 35,448,466 (GRCm39) missense probably benign 0.19
R1195:Sema5b UTSW 16 35,472,030 (GRCm39) missense probably null 0.94
R1195:Sema5b UTSW 16 35,472,030 (GRCm39) missense probably null 0.94
R1666:Sema5b UTSW 16 35,478,852 (GRCm39) missense probably benign 0.03
R1706:Sema5b UTSW 16 35,470,125 (GRCm39) missense probably damaging 0.98
R1733:Sema5b UTSW 16 35,466,737 (GRCm39) missense probably damaging 1.00
R1775:Sema5b UTSW 16 35,480,694 (GRCm39) missense probably benign
R2215:Sema5b UTSW 16 35,480,585 (GRCm39) missense probably damaging 1.00
R2844:Sema5b UTSW 16 35,480,301 (GRCm39) missense probably damaging 0.98
R3086:Sema5b UTSW 16 35,443,093 (GRCm39) missense probably benign
R3613:Sema5b UTSW 16 35,480,520 (GRCm39) missense probably benign
R4774:Sema5b UTSW 16 35,483,552 (GRCm39) missense probably damaging 1.00
R5743:Sema5b UTSW 16 35,478,846 (GRCm39) missense probably damaging 1.00
R5856:Sema5b UTSW 16 35,466,756 (GRCm39) nonsense probably null
R5993:Sema5b UTSW 16 35,466,572 (GRCm39) missense probably damaging 1.00
R6248:Sema5b UTSW 16 35,448,377 (GRCm39) splice site probably null
R6420:Sema5b UTSW 16 35,483,516 (GRCm39) missense probably benign 0.08
R6795:Sema5b UTSW 16 35,478,941 (GRCm39) nonsense probably null
R6825:Sema5b UTSW 16 35,448,377 (GRCm39) splice site probably null
R7066:Sema5b UTSW 16 35,471,682 (GRCm39) missense probably benign 0.26
R7244:Sema5b UTSW 16 35,480,915 (GRCm39) missense probably benign
R7446:Sema5b UTSW 16 35,467,573 (GRCm39) missense probably damaging 1.00
R7497:Sema5b UTSW 16 35,481,700 (GRCm39) missense probably damaging 1.00
R7516:Sema5b UTSW 16 35,471,540 (GRCm39) missense probably benign 0.05
R7878:Sema5b UTSW 16 35,481,996 (GRCm39) missense probably benign 0.00
R8397:Sema5b UTSW 16 35,471,691 (GRCm39) missense possibly damaging 0.59
R8537:Sema5b UTSW 16 35,471,979 (GRCm39) missense possibly damaging 0.49
R8929:Sema5b UTSW 16 35,467,737 (GRCm39) intron probably benign
R9262:Sema5b UTSW 16 35,453,223 (GRCm39) missense possibly damaging 0.57
R9389:Sema5b UTSW 16 35,466,092 (GRCm39) missense probably damaging 1.00
R9579:Sema5b UTSW 16 35,467,582 (GRCm39) missense probably benign 0.01
R9623:Sema5b UTSW 16 35,443,121 (GRCm39) missense possibly damaging 0.74
Z1088:Sema5b UTSW 16 35,480,960 (GRCm39) missense probably damaging 0.99
Z1176:Sema5b UTSW 16 35,470,234 (GRCm39) missense probably benign 0.01
Z1176:Sema5b UTSW 16 35,466,643 (GRCm39) missense probably benign 0.05
Z1176:Sema5b UTSW 16 35,448,388 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGCATAGAAAGAGGTGCC -3'
(R):5'- TCACACGGTTTCCATGGTGAC -3'

Sequencing Primer
(F):5'- CCACAGTGGGGTTGTCCAG -3'
(R):5'- TCGTACCTGCAGACTCATATAAGGG -3'
Posted On 2020-09-15