Incidental Mutation 'R7922:Heatr5b'
ID 648493
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene Name HEAT repeat containing 5B
Synonyms A230048G03Rik, D330050P16Rik, 2010013B10Rik
MMRRC Submission 045969-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.461) question?
Stock # R7922 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 79060327-79142793 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79067988 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 1800 (Q1800L)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
AlphaFold Q8C547
Predicted Effect probably benign
Transcript: ENSMUST00000097281
AA Change: Q1800L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: Q1800L

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,211,180 (GRCm39) T638M possibly damaging Het
4930546C10Rik A G 18: 69,083,067 (GRCm39) probably null Het
Abi3 A T 11: 95,723,619 (GRCm39) Y342N unknown Het
Adk G A 14: 21,368,111 (GRCm39) V195I probably benign Het
Ago2 C T 15: 72,998,375 (GRCm39) V268M possibly damaging Het
Apaf1 T C 10: 90,835,615 (GRCm39) I1077V probably benign Het
Arap1 A T 7: 101,053,621 (GRCm39) K1317* probably null Het
Auts2 T A 5: 131,469,211 (GRCm39) D493V Het
Baz1b A T 5: 135,260,533 (GRCm39) Q1110L probably damaging Het
Brsk2 T A 7: 141,546,957 (GRCm39) S467T possibly damaging Het
Btbd9 A T 17: 30,493,858 (GRCm39) M511K probably benign Het
Cdh23 T A 10: 60,218,485 (GRCm39) Y1385F probably benign Het
Cfap100 A C 6: 90,380,962 (GRCm39) L427V unknown Het
Cnga1 A G 5: 72,762,225 (GRCm39) F430L possibly damaging Het
Csnk2a1-ps3 A T 1: 156,352,562 (GRCm39) L254F probably damaging Het
Dnhd1 A T 7: 105,317,721 (GRCm39) D472V probably damaging Het
Dock2 T A 11: 34,598,154 (GRCm39) E339V probably benign Het
Eif3a A T 19: 60,764,280 (GRCm39) V379E probably damaging Het
Erich4 T A 7: 25,315,168 (GRCm39) N36Y probably damaging Het
Frem2 T C 3: 53,560,725 (GRCm39) T1261A probably damaging Het
Fzd6 A T 15: 38,894,503 (GRCm39) D223V probably damaging Het
Gabra2 A T 5: 71,165,315 (GRCm39) Y218* probably null Het
Gcn1 G T 5: 115,752,527 (GRCm39) M2177I probably benign Het
Ghr G A 15: 3,370,556 (GRCm39) T103I possibly damaging Het
Gipc1 T C 8: 84,387,857 (GRCm39) V79A probably benign Het
Gm13272 T A 4: 88,698,577 (GRCm39) V164D probably damaging Het
Gramd4 C A 15: 86,016,159 (GRCm39) H503Q probably benign Het
Gstm4 A T 3: 107,951,987 (GRCm39) M1K probably null Het
Hectd1 T A 12: 51,836,978 (GRCm39) K826* probably null Het
Hoxa9 T C 6: 52,201,289 (GRCm39) I251V possibly damaging Het
Il2ra A T 2: 11,679,177 (GRCm39) I46F possibly damaging Het
Ints2 T A 11: 86,135,453 (GRCm39) R320S probably benign Het
Iscu A T 5: 113,912,343 (GRCm39) N46I probably damaging Het
Iscu G A 5: 113,912,410 (GRCm39) R60Q unknown Het
Kcnk3 A T 5: 30,745,875 (GRCm39) H72L probably damaging Het
Kmt2a T G 9: 44,754,157 (GRCm39) S1228R unknown Het
Mbl2 T A 19: 30,216,638 (GRCm39) L150Q probably damaging Het
Med13 A T 11: 86,161,831 (GRCm39) F2166Y probably damaging Het
Mterf4 A C 1: 93,229,275 (GRCm39) L246* probably null Het
Muc16 T C 9: 18,496,121 (GRCm39) Q6690R probably benign Het
Myh10 T A 11: 68,699,719 (GRCm39) L1722Q possibly damaging Het
Neurod2 T C 11: 98,218,454 (GRCm39) M237V probably benign Het
Olfml1 A G 7: 107,170,356 (GRCm39) Y81C probably damaging Het
Or4q3 A G 14: 50,583,872 (GRCm39) V9A probably benign Het
Pcdhga7 A T 18: 37,849,226 (GRCm39) N411I probably benign Het
Pcdhgb8 T C 18: 37,897,002 (GRCm39) F691L probably benign Het
Pik3c2a A G 7: 115,990,517 (GRCm39) V481A probably damaging Het
Pik3r6 A T 11: 68,424,701 (GRCm39) R435S probably benign Het
Pkd1l1 G A 11: 8,799,013 (GRCm39) H2250Y Het
Pkd1l1 A G 11: 8,859,857 (GRCm39) S1034P Het
Plcd1 C A 9: 118,903,720 (GRCm39) R400L possibly damaging Het
Ppp2r1a A G 17: 21,174,879 (GRCm39) T58A probably benign Het
Ppp5c T C 7: 16,761,725 (GRCm39) E5G possibly damaging Het
Pradc1 A C 6: 85,424,950 (GRCm39) F82L probably benign Het
Prkag3 A T 1: 74,780,416 (GRCm39) S416R probably benign Het
Rab3gap2 T C 1: 184,982,117 (GRCm39) C390R probably benign Het
Rhot1 A G 11: 80,156,629 (GRCm39) T655A probably benign Het
Rorc A G 3: 94,298,495 (GRCm39) I348V probably damaging Het
Ryr1 A T 7: 28,796,649 (GRCm39) V1051E probably benign Het
Sema5b GCAC GC 16: 35,478,626 (GRCm39) probably null Het
Serpinb3c G A 1: 107,199,744 (GRCm39) T259I probably damaging Het
Sh3gl1 A T 17: 56,326,438 (GRCm39) M70K probably damaging Het
Sinhcaf T A 6: 148,827,644 (GRCm39) T125S probably benign Het
Slc7a4 C T 16: 17,391,230 (GRCm39) V607I probably benign Het
Spop A T 11: 95,362,154 (GRCm39) N62Y probably damaging Het
Spout1 A G 2: 30,066,823 (GRCm39) F130S probably benign Het
Tab1 A G 15: 80,043,066 (GRCm39) H420R possibly damaging Het
Tecpr2 CA C 12: 110,899,076 (GRCm39) probably null Het
Tnxb G C 17: 34,933,577 (GRCm39) K2332N probably damaging Het
Togaram1 T C 12: 65,014,512 (GRCm39) Y588H probably damaging Het
Trim71 G A 9: 114,342,153 (GRCm39) R710C probably damaging Het
Tsen54 C T 11: 115,711,608 (GRCm39) Q342* probably null Het
Ube2r2 T A 4: 41,190,812 (GRCm39) N235K unknown Het
Utrn C A 10: 12,543,271 (GRCm39) K1792N possibly damaging Het
Vmn1r122 A G 7: 20,867,587 (GRCm39) I156T possibly damaging Het
Vmn1r94 T C 7: 19,901,636 (GRCm39) T223A possibly damaging Het
Vmn2r120 G A 17: 57,831,683 (GRCm39) R369W probably damaging Het
Vwa7 G T 17: 35,243,409 (GRCm39) A717S possibly damaging Het
Zc3h4 T A 7: 16,159,647 (GRCm39) C398S unknown Het
Zc3hc1 T A 6: 30,390,874 (GRCm39) E43V possibly damaging Het
Zfp101 A T 17: 33,600,511 (GRCm39) V415D possibly damaging Het
Zfp553 A G 7: 126,835,768 (GRCm39) H441R probably damaging Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 79,110,863 (GRCm39) missense probably damaging 1.00
IGL00418:Heatr5b APN 17 79,060,570 (GRCm39) missense probably damaging 1.00
IGL00786:Heatr5b APN 17 79,132,063 (GRCm39) missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 79,072,866 (GRCm39) missense probably damaging 1.00
IGL01362:Heatr5b APN 17 79,123,767 (GRCm39) splice site probably benign
IGL01419:Heatr5b APN 17 79,103,939 (GRCm39) missense probably benign 0.19
IGL01447:Heatr5b APN 17 79,137,026 (GRCm39) missense probably benign 0.00
IGL01591:Heatr5b APN 17 79,115,901 (GRCm39) missense probably benign 0.01
IGL01743:Heatr5b APN 17 79,132,069 (GRCm39) nonsense probably null
IGL01860:Heatr5b APN 17 79,115,909 (GRCm39) missense probably damaging 0.98
IGL01862:Heatr5b APN 17 79,103,914 (GRCm39) missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 79,103,926 (GRCm39) missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 79,115,855 (GRCm39) missense probably damaging 1.00
IGL02097:Heatr5b APN 17 79,124,943 (GRCm39) missense probably damaging 1.00
IGL02168:Heatr5b APN 17 79,139,020 (GRCm39) unclassified probably benign
IGL02399:Heatr5b APN 17 79,135,396 (GRCm39) missense probably damaging 0.99
IGL02540:Heatr5b APN 17 79,081,001 (GRCm39) missense probably damaging 1.00
IGL02719:Heatr5b APN 17 79,122,969 (GRCm39) missense probably damaging 1.00
IGL02824:Heatr5b APN 17 79,081,109 (GRCm39) missense probably damaging 1.00
IGL02965:Heatr5b APN 17 79,060,502 (GRCm39) missense probably benign 0.37
IGL03032:Heatr5b APN 17 79,067,928 (GRCm39) missense probably benign 0.45
IGL03243:Heatr5b APN 17 79,070,509 (GRCm39) splice site probably benign
IGL03259:Heatr5b APN 17 79,098,985 (GRCm39) missense probably damaging 1.00
IGL03349:Heatr5b APN 17 79,062,749 (GRCm39) missense probably benign 0.01
R5470_heatr5b_501 UTSW 17 79,129,008 (GRCm39) splice site probably null
R0124:Heatr5b UTSW 17 79,133,646 (GRCm39) splice site probably benign
R0285:Heatr5b UTSW 17 79,115,882 (GRCm39) missense probably benign 0.05
R0335:Heatr5b UTSW 17 79,135,375 (GRCm39) missense probably benign 0.15
R0412:Heatr5b UTSW 17 79,128,283 (GRCm39) missense probably benign 0.04
R0601:Heatr5b UTSW 17 79,075,974 (GRCm39) missense probably benign
R0725:Heatr5b UTSW 17 79,103,825 (GRCm39) missense probably benign 0.03
R1178:Heatr5b UTSW 17 79,120,698 (GRCm39) missense probably damaging 1.00
R1444:Heatr5b UTSW 17 79,062,856 (GRCm39) splice site probably benign
R1444:Heatr5b UTSW 17 79,060,622 (GRCm39) missense probably benign 0.17
R1453:Heatr5b UTSW 17 79,124,992 (GRCm39) missense probably damaging 1.00
R1469:Heatr5b UTSW 17 79,115,813 (GRCm39) missense probably damaging 1.00
R1469:Heatr5b UTSW 17 79,115,813 (GRCm39) missense probably damaging 1.00
R1506:Heatr5b UTSW 17 79,060,576 (GRCm39) missense probably damaging 1.00
R1819:Heatr5b UTSW 17 79,098,940 (GRCm39) missense probably damaging 0.98
R1835:Heatr5b UTSW 17 79,080,992 (GRCm39) missense probably damaging 1.00
R1837:Heatr5b UTSW 17 79,128,180 (GRCm39) missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 79,103,347 (GRCm39) missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 79,121,613 (GRCm39) missense probably damaging 1.00
R2037:Heatr5b UTSW 17 79,136,934 (GRCm39) nonsense probably null
R2154:Heatr5b UTSW 17 79,138,873 (GRCm39) missense probably benign 0.00
R2190:Heatr5b UTSW 17 79,109,185 (GRCm39) missense probably damaging 1.00
R2191:Heatr5b UTSW 17 79,081,106 (GRCm39) missense probably damaging 1.00
R2413:Heatr5b UTSW 17 79,064,290 (GRCm39) critical splice donor site probably null
R3424:Heatr5b UTSW 17 79,075,833 (GRCm39) missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 79,141,646 (GRCm39) missense probably damaging 1.00
R3759:Heatr5b UTSW 17 79,131,969 (GRCm39) missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 79,137,071 (GRCm39) missense probably damaging 1.00
R4127:Heatr5b UTSW 17 79,060,603 (GRCm39) missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 79,064,351 (GRCm39) missense probably benign 0.00
R4345:Heatr5b UTSW 17 79,067,940 (GRCm39) missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 79,118,025 (GRCm39) missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 79,102,548 (GRCm39) missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 79,128,130 (GRCm39) missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 79,069,689 (GRCm39) missense probably benign 0.18
R4960:Heatr5b UTSW 17 79,139,013 (GRCm39) missense probably benign 0.01
R5037:Heatr5b UTSW 17 79,131,939 (GRCm39) missense probably benign 0.00
R5051:Heatr5b UTSW 17 79,102,703 (GRCm39) missense probably damaging 1.00
R5153:Heatr5b UTSW 17 79,102,536 (GRCm39) nonsense probably null
R5328:Heatr5b UTSW 17 79,133,791 (GRCm39) missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 79,135,415 (GRCm39) missense probably benign 0.44
R5426:Heatr5b UTSW 17 79,081,142 (GRCm39) missense probably damaging 1.00
R5470:Heatr5b UTSW 17 79,129,008 (GRCm39) splice site probably null
R5472:Heatr5b UTSW 17 79,109,089 (GRCm39) missense probably damaging 1.00
R5553:Heatr5b UTSW 17 79,060,780 (GRCm39) splice site probably null
R5706:Heatr5b UTSW 17 79,074,304 (GRCm39) splice site probably null
R5804:Heatr5b UTSW 17 79,138,951 (GRCm39) missense probably damaging 0.97
R5978:Heatr5b UTSW 17 79,113,465 (GRCm39) missense probably damaging 0.99
R6122:Heatr5b UTSW 17 79,120,602 (GRCm39) missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 79,138,870 (GRCm39) missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 79,081,106 (GRCm39) missense probably damaging 1.00
R6221:Heatr5b UTSW 17 79,074,383 (GRCm39) missense probably benign 0.05
R6255:Heatr5b UTSW 17 79,110,863 (GRCm39) missense probably damaging 1.00
R6291:Heatr5b UTSW 17 79,069,526 (GRCm39) missense probably benign 0.08
R6455:Heatr5b UTSW 17 79,060,502 (GRCm39) missense probably benign 0.37
R6524:Heatr5b UTSW 17 79,121,535 (GRCm39) missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 79,070,418 (GRCm39) missense probably damaging 1.00
R6899:Heatr5b UTSW 17 79,110,938 (GRCm39) missense probably benign 0.03
R7084:Heatr5b UTSW 17 79,117,992 (GRCm39) missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 79,135,417 (GRCm39) missense probably damaging 1.00
R7148:Heatr5b UTSW 17 79,138,863 (GRCm39) missense probably damaging 0.99
R7382:Heatr5b UTSW 17 79,110,936 (GRCm39) missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 79,115,909 (GRCm39) missense probably damaging 1.00
R7436:Heatr5b UTSW 17 79,075,962 (GRCm39) missense probably benign
R7519:Heatr5b UTSW 17 79,062,646 (GRCm39) missense probably benign
R7606:Heatr5b UTSW 17 79,070,455 (GRCm39) missense probably benign
R7673:Heatr5b UTSW 17 79,103,412 (GRCm39) missense probably damaging 0.97
R7782:Heatr5b UTSW 17 79,103,370 (GRCm39) missense probably damaging 0.99
R7790:Heatr5b UTSW 17 79,126,252 (GRCm39) missense probably damaging 0.99
R8184:Heatr5b UTSW 17 79,121,662 (GRCm39) missense probably benign 0.03
R8222:Heatr5b UTSW 17 79,109,130 (GRCm39) missense possibly damaging 0.95
R8276:Heatr5b UTSW 17 79,098,968 (GRCm39) nonsense probably null
R8324:Heatr5b UTSW 17 79,062,793 (GRCm39) missense possibly damaging 0.85
R8430:Heatr5b UTSW 17 79,137,053 (GRCm39) missense probably damaging 0.97
R8432:Heatr5b UTSW 17 79,110,930 (GRCm39) missense probably damaging 0.99
R8672:Heatr5b UTSW 17 79,069,632 (GRCm39) missense probably damaging 1.00
R8781:Heatr5b UTSW 17 79,102,738 (GRCm39) missense probably benign 0.19
R8794:Heatr5b UTSW 17 79,123,015 (GRCm39) missense probably benign 0.00
R8808:Heatr5b UTSW 17 79,072,834 (GRCm39) missense possibly damaging 0.92
R8850:Heatr5b UTSW 17 79,109,188 (GRCm39) missense probably benign 0.02
R8893:Heatr5b UTSW 17 79,069,424 (GRCm39) splice site probably benign
R9010:Heatr5b UTSW 17 79,081,139 (GRCm39) missense probably damaging 1.00
R9041:Heatr5b UTSW 17 79,103,861 (GRCm39) missense probably benign 0.12
R9150:Heatr5b UTSW 17 79,103,448 (GRCm39) missense probably benign
R9253:Heatr5b UTSW 17 79,135,423 (GRCm39) missense probably benign 0.13
R9318:Heatr5b UTSW 17 79,072,831 (GRCm39) missense probably benign 0.07
R9448:Heatr5b UTSW 17 79,068,015 (GRCm39) missense probably benign 0.26
R9489:Heatr5b UTSW 17 79,060,679 (GRCm39) nonsense probably null
R9649:Heatr5b UTSW 17 79,141,524 (GRCm39) critical splice donor site probably null
X0022:Heatr5b UTSW 17 79,067,974 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGCAGTCTCCTTCAAGGTTATTCAA -3'
(R):5'- CAATCATGAGCCCTTAACTGAGG -3'

Sequencing Primer
(F):5'- CAGCCTAGTCTACAGAGTGAGTTAC -3'
(R):5'- AAACAATATGTGTGTGTCTGTGCC -3'
Posted On 2020-09-15