Incidental Mutation 'R7922:Heatr5b'
ID648493
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene NameHEAT repeat containing 5B
Synonyms2010013B10Rik, A230048G03Rik, D330050P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.525) question?
Stock #R7922 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location78752906-78835381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78760559 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1800 (Q1800L)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
Predicted Effect probably benign
Transcript: ENSMUST00000097281
AA Change: Q1800L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: Q1800L

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,164,406 T638M possibly damaging Het
4930546C10Rik A G 18: 68,949,996 probably null Het
Abi3 A T 11: 95,832,793 Y342N unknown Het
Adk G A 14: 21,318,043 V195I probably benign Het
Ago2 C T 15: 73,126,526 V268M possibly damaging Het
Apaf1 T C 10: 90,999,753 I1077V probably benign Het
Arap1 A T 7: 101,404,414 K1317* probably null Het
Auts2 T A 5: 131,440,373 D493V Het
Baz1b A T 5: 135,231,679 Q1110L probably damaging Het
Brsk2 T A 7: 141,993,220 S467T possibly damaging Het
Btbd9 A T 17: 30,274,884 M511K probably benign Het
Cdh23 T A 10: 60,382,706 Y1385F probably benign Het
Cfap100 A C 6: 90,403,980 L427V unknown Het
Cnga1 A G 5: 72,604,882 F430L possibly damaging Het
Dnhd1 A T 7: 105,668,514 D472V probably damaging Het
Dock2 T A 11: 34,707,327 E339V probably benign Het
Eif3a A T 19: 60,775,842 V379E probably damaging Het
Erich4 T A 7: 25,615,743 N36Y probably damaging Het
Fam60a T A 6: 148,926,146 T125S probably benign Het
Frem2 T C 3: 53,653,304 T1261A probably damaging Het
Fzd6 A T 15: 39,031,108 D223V probably damaging Het
Gabra2 A T 5: 71,007,972 Y218* probably null Het
Gcn1l1 G T 5: 115,614,468 M2177I probably benign Het
Ghr G A 15: 3,341,074 T103I possibly damaging Het
Gipc1 T C 8: 83,661,228 V79A probably benign Het
Gm10031 A T 1: 156,524,992 L254F probably damaging Het
Gm13272 T A 4: 88,780,340 V164D probably damaging Het
Gramd4 C A 15: 86,131,958 H503Q probably benign Het
Gstm4 A T 3: 108,044,671 M1K probably null Het
Hectd1 T A 12: 51,790,195 K826* probably null Het
Hoxa9 T C 6: 52,224,309 I251V possibly damaging Het
Il2ra A T 2: 11,674,366 I46F possibly damaging Het
Ints2 T A 11: 86,244,627 R320S probably benign Het
Iscu A T 5: 113,774,282 N46I probably damaging Het
Iscu G A 5: 113,774,349 R60Q unknown Het
Kcnk3 A T 5: 30,588,531 H72L probably damaging Het
Kmt2a T G 9: 44,842,860 S1228R unknown Het
Mbl2 T A 19: 30,239,238 L150Q probably damaging Het
Med13 A T 11: 86,271,005 F2166Y probably damaging Het
Mterf4 A C 1: 93,301,553 L246* probably null Het
Muc16 T C 9: 18,584,825 Q6690R probably benign Het
Myh10 T A 11: 68,808,893 L1722Q possibly damaging Het
Neurod2 T C 11: 98,327,628 M237V probably benign Het
Olfml1 A G 7: 107,571,149 Y81C probably damaging Het
Olfr735 A G 14: 50,346,415 V9A probably benign Het
Pcdhga7 A T 18: 37,716,173 N411I probably benign Het
Pcdhgb8 T C 18: 37,763,949 F691L probably benign Het
Pik3c2a A G 7: 116,391,282 V481A probably damaging Het
Pik3r6 A T 11: 68,533,875 R435S probably benign Het
Pkd1l1 G A 11: 8,849,013 H2250Y Het
Pkd1l1 A G 11: 8,909,857 S1034P Het
Plcd1 C A 9: 119,074,652 R400L possibly damaging Het
Ppp2r1a A G 17: 20,954,617 T58A probably benign Het
Ppp5c T C 7: 17,027,800 E5G possibly damaging Het
Pradc1 A C 6: 85,447,968 F82L probably benign Het
Prkag3 A T 1: 74,741,257 S416R probably benign Het
Rab3gap2 T C 1: 185,249,920 C390R probably benign Het
Rhot1 A G 11: 80,265,803 T655A probably benign Het
Rorc A G 3: 94,391,188 I348V probably damaging Het
Ryr1 A T 7: 29,097,224 V1051E probably benign Het
Sema5b GCAC GC 16: 35,658,256 probably null Het
Serpinb3c G A 1: 107,272,014 T259I probably damaging Het
Sh3gl1 A T 17: 56,019,438 M70K probably damaging Het
Slc7a4 C T 16: 17,573,366 V607I probably benign Het
Spop A T 11: 95,471,328 N62Y probably damaging Het
Spout1 A G 2: 30,176,811 F130S probably benign Het
Tab1 A G 15: 80,158,865 H420R possibly damaging Het
Tecpr2 CA C 12: 110,932,642 probably null Het
Tnxb G C 17: 34,714,603 K2332N probably damaging Het
Togaram1 T C 12: 64,967,738 Y588H probably damaging Het
Trim71 G A 9: 114,513,085 R710C probably damaging Het
Tsen54 C T 11: 115,820,782 Q342* probably null Het
Ube2r2 T A 4: 41,190,812 N235K unknown Het
Utrn C A 10: 12,667,527 K1792N possibly damaging Het
Vmn1r122 A G 7: 21,133,662 I156T possibly damaging Het
Vmn1r94 T C 7: 20,167,711 T223A possibly damaging Het
Vmn2r120 G A 17: 57,524,683 R369W probably damaging Het
Vwa7 G T 17: 35,024,433 A717S possibly damaging Het
Zc3h4 T A 7: 16,425,722 C398S unknown Het
Zc3hc1 T A 6: 30,390,875 E43V possibly damaging Het
Zfp101 A T 17: 33,381,537 V415D possibly damaging Het
Zfp553 A G 7: 127,236,596 H441R probably damaging Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7436:Heatr5b UTSW 17 78768533 missense probably benign
R7519:Heatr5b UTSW 17 78755217 missense probably benign
R7606:Heatr5b UTSW 17 78763026 missense probably benign
R7673:Heatr5b UTSW 17 78795983 missense probably damaging 0.97
R7782:Heatr5b UTSW 17 78795941 missense probably damaging 0.99
R7790:Heatr5b UTSW 17 78818823 missense probably damaging 0.99
R8184:Heatr5b UTSW 17 78814233 missense probably benign 0.03
R8222:Heatr5b UTSW 17 78801701 missense possibly damaging 0.95
R8276:Heatr5b UTSW 17 78791539 nonsense probably null
R8324:Heatr5b UTSW 17 78755364 missense possibly damaging 0.85
R8430:Heatr5b UTSW 17 78829624 missense probably damaging 0.97
R8432:Heatr5b UTSW 17 78803501 missense probably damaging 0.99
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGCAGTCTCCTTCAAGGTTATTCAA -3'
(R):5'- CAATCATGAGCCCTTAACTGAGG -3'

Sequencing Primer
(F):5'- CAGCCTAGTCTACAGAGTGAGTTAC -3'
(R):5'- AAACAATATGTGTGTGTCTGTGCC -3'
Posted On2020-09-15