Incidental Mutation 'R7923:Erbb4'
ID648501
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7923 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 68259209 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 684 (R684H)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
Predicted Effect possibly damaging
Transcript: ENSMUST00000119142
AA Change: R684H

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: R684H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121473
AA Change: R684H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: R684H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153432
AA Change: R674H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: R674H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C T 8: 72,444,911 T54M probably damaging Het
4932443I19Rik A C 8: 13,738,456 H140P unknown Het
Aacs T A 5: 125,511,884 S409T probably damaging Het
Atf6 T C 1: 170,794,706 M449V probably benign Het
B4galt1 C T 4: 40,809,373 G332S probably benign Het
Bcl11a G T 11: 24,163,680 R341M probably damaging Het
Brf2 G A 8: 27,124,190 Q323* probably null Het
Bscl2 T C 19: 8,847,519 V322A probably benign Het
Btnl9 T C 11: 49,180,738 Y86C probably damaging Het
C4b T A 17: 34,742,380 I202F probably damaging Het
Cbfb T A 8: 105,194,593 probably null Het
Cc2d2b T A 19: 40,806,849 Y963N possibly damaging Het
Cep135 A T 5: 76,609,692 D391V possibly damaging Het
Col12a1 A G 9: 79,678,493 V1228A probably benign Het
Cr2 T A 1: 195,168,687 Y157F probably benign Het
Creg2 C T 1: 39,650,903 G13E probably benign Het
Cul5 G T 9: 53,624,166 A595E probably benign Het
Cyp4f16 A G 17: 32,546,747 E368G possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Eps15 G A 4: 109,315,872 D177N possibly damaging Het
Ermp1 C T 19: 29,628,658 V419I probably benign Het
Foxi3 T C 6: 70,960,716 S311P probably benign Het
Fras1 C T 5: 96,739,318 A2653V probably damaging Het
Gbp3 A T 3: 142,567,612 N307Y probably damaging Het
Ggcx G A 6: 72,427,917 R436Q probably damaging Het
Gimap3 A T 6: 48,765,627 V123D probably benign Het
Gm14326 A T 2: 177,945,887 Y439N probably damaging Het
Gm4756 G T 12: 72,619,358 Q180K probably benign Het
Gm5591 A G 7: 38,521,914 S244P probably benign Het
Gm9507 A T 10: 77,811,537 C103S unknown Het
Guf1 G A 5: 69,561,159 V214I probably benign Het
Ido2 T C 8: 24,576,193 Y19C probably damaging Het
Idua T C 5: 108,680,583 S268P probably damaging Het
Igf1r T C 7: 68,190,101 Y719H probably damaging Het
Itgb4 A T 11: 115,982,699 probably null Het
Kctd19 T A 8: 105,385,058 T868S probably damaging Het
Lonrf2 A T 1: 38,800,762 H417Q probably benign Het
Lrp2 T C 2: 69,438,388 T4184A possibly damaging Het
Mapk15 T C 15: 75,996,446 F219S probably damaging Het
Myh7b A T 2: 155,625,966 Y808F probably benign Het
Myo19 T G 11: 84,885,710 F64C possibly damaging Het
Mysm1 A T 4: 94,961,765 V434D probably damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nbeal2 A T 9: 110,631,446 Y1780* probably null Het
Ndc80 A T 17: 71,496,301 M615K probably benign Het
Nfkbib C A 7: 28,766,263 V54F probably damaging Het
Npy5r A G 8: 66,681,752 F130L probably damaging Het
Nt5c3 T C 6: 56,883,042 E304G probably benign Het
Odaph A G 5: 91,994,699 D40G possibly damaging Het
Olfr1389 C T 11: 49,430,605 T43I probably benign Het
Olfr1469 T C 19: 13,410,818 M83T probably benign Het
Olfr695 T A 7: 106,714,442 K80* probably null Het
Olfr974 A T 9: 39,942,967 K236* probably null Het
Palm3 T A 8: 84,029,461 I534K probably benign Het
Pde10a A G 17: 8,929,132 N89S probably benign Het
Piezo1 T C 8: 122,496,444 K870E Het
Pik3c2g T C 6: 139,633,793 probably null Het
Pnpla6 T A 8: 3,531,737 Y662* probably null Het
Proser3 A T 7: 30,549,661 F2Y possibly damaging Het
Psma5 A G 3: 108,265,129 I54V probably benign Het
Qrich2 C A 11: 116,457,337 G887V probably damaging Het
Rdx A G 9: 52,065,901 D150G possibly damaging Het
Reln C T 5: 22,134,692 V221I probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Samd14 A G 11: 95,023,458 probably null Het
Scimp A T 11: 70,791,515 I125N possibly damaging Het
Sec23a A G 12: 58,992,247 F289L probably damaging Het
Sipa1l3 G A 7: 29,339,146 Q1408* probably null Het
Skor2 T C 18: 76,858,721 L46P unknown Het
Slc12a1 A T 2: 125,214,092 I848F possibly damaging Het
Slc47a1 A G 11: 61,363,403 L211P probably damaging Het
Slc7a10 T C 7: 35,195,129 V71A probably damaging Het
Smco1 C A 16: 32,274,047 Q179K possibly damaging Het
Smg1 A G 7: 118,143,322 L3223P possibly damaging Het
Smpdl3a T C 10: 57,801,045 S80P probably damaging Het
Spire2 A G 8: 123,332,987 R75G probably benign Het
Sptbn2 T A 19: 4,746,799 H1808Q probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Ssfa2 G T 2: 79,662,615 E1169* probably null Het
Supv3l1 T C 10: 62,445,081 D177G probably damaging Het
Syne1 C T 10: 5,264,738 E3215K probably damaging Het
Szt2 A G 4: 118,373,840 V2548A unknown Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Washc2 A G 6: 116,226,424 E384G possibly damaging Het
Zfp712 T A 13: 67,042,185 N93Y probably benign Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
earthworm UTSW 1 68250580 missense possibly damaging 0.67
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7509:Erbb4 UTSW 1 68250580 missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68254599 missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68328119 missense probably benign 0.00
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68396311 missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68298350 missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68309626 missense probably benign
R8783:Erbb4 UTSW 1 68040172 missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68075468 missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68343838 critical splice donor site probably null
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAAACAGAGCATCATCTAGCTG -3'
(R):5'- AGTGTGGAAATTGCCTCATGC -3'

Sequencing Primer
(F):5'- CTTTATATGCCCCAGTACAGGAG -3'
(R):5'- GCCTCATGCAGCTGCTTTTTC -3'
Posted On2020-09-15