Incidental Mutation 'R7923:Erbb4'
ID 648501
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Name erb-b2 receptor tyrosine kinase 4
Synonyms Her4, ErbB4
MMRRC Submission 045970-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7923 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 68071345-69147218 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 68298368 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 684 (R684H)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
AlphaFold Q61527
Predicted Effect possibly damaging
Transcript: ENSMUST00000119142
AA Change: R684H

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: R684H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121473
AA Change: R684H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: R684H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153432
AA Change: R674H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: R674H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C T 8: 73,198,755 (GRCm39) T54M probably damaging Het
Aacs T A 5: 125,588,948 (GRCm39) S409T probably damaging Het
Atf6 T C 1: 170,622,275 (GRCm39) M449V probably benign Het
B4galt1 C T 4: 40,809,373 (GRCm39) G332S probably benign Het
Bcl11a G T 11: 24,113,680 (GRCm39) R341M probably damaging Het
Brf2 G A 8: 27,614,218 (GRCm39) Q323* probably null Het
Bscl2 T C 19: 8,824,883 (GRCm39) V322A probably benign Het
Btnl9 T C 11: 49,071,565 (GRCm39) Y86C probably damaging Het
C4b T A 17: 34,961,354 (GRCm39) I202F probably damaging Het
Cbfb T A 8: 105,921,225 (GRCm39) probably null Het
Cc2d2b T A 19: 40,795,293 (GRCm39) Y963N possibly damaging Het
Cep135 A T 5: 76,757,539 (GRCm39) D391V possibly damaging Het
Cfap97d2 A C 8: 13,788,456 (GRCm39) H140P unknown Het
Col12a1 A G 9: 79,585,775 (GRCm39) V1228A probably benign Het
Cr2 T A 1: 194,850,995 (GRCm39) Y157F probably benign Het
Creg2 C T 1: 39,690,071 (GRCm39) G13E probably benign Het
Cul5 G T 9: 53,535,466 (GRCm39) A595E probably benign Het
Cyp4f16 A G 17: 32,765,721 (GRCm39) E368G possibly damaging Het
Dhrs7l G T 12: 72,666,132 (GRCm39) Q180K probably benign Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,739,935 (GRCm39) probably benign Het
Eps15 G A 4: 109,173,069 (GRCm39) D177N possibly damaging Het
Ermp1 C T 19: 29,606,058 (GRCm39) V419I probably benign Het
Foxi3 T C 6: 70,937,700 (GRCm39) S311P probably benign Het
Fras1 C T 5: 96,887,177 (GRCm39) A2653V probably damaging Het
Gbp3 A T 3: 142,273,373 (GRCm39) N307Y probably damaging Het
Ggcx G A 6: 72,404,900 (GRCm39) R436Q probably damaging Het
Gimap3 A T 6: 48,742,561 (GRCm39) V123D probably benign Het
Gm14326 A T 2: 177,587,680 (GRCm39) Y439N probably damaging Het
Gm5591 A G 7: 38,221,338 (GRCm39) S244P probably benign Het
Gm9507 A T 10: 77,647,371 (GRCm39) C103S unknown Het
Guf1 G A 5: 69,718,502 (GRCm39) V214I probably benign Het
Ido2 T C 8: 25,066,209 (GRCm39) Y19C probably damaging Het
Idua T C 5: 108,828,449 (GRCm39) S268P probably damaging Het
Igf1r T C 7: 67,839,849 (GRCm39) Y719H probably damaging Het
Itgb4 A T 11: 115,873,525 (GRCm39) probably null Het
Itprid2 G T 2: 79,492,959 (GRCm39) E1169* probably null Het
Kctd19 T A 8: 106,111,690 (GRCm39) T868S probably damaging Het
Lonrf2 A T 1: 38,839,843 (GRCm39) H417Q probably benign Het
Lrp2 T C 2: 69,268,732 (GRCm39) T4184A possibly damaging Het
Mapk15 T C 15: 75,868,295 (GRCm39) F219S probably damaging Het
Myh7b A T 2: 155,467,886 (GRCm39) Y808F probably benign Het
Myo19 T G 11: 84,776,536 (GRCm39) F64C possibly damaging Het
Mysm1 A T 4: 94,850,002 (GRCm39) V434D probably damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 67,313,200 (GRCm39) probably benign Het
Nbeal2 A T 9: 110,460,514 (GRCm39) Y1780* probably null Het
Ndc80 A T 17: 71,803,296 (GRCm39) M615K probably benign Het
Nfkbib C A 7: 28,465,688 (GRCm39) V54F probably damaging Het
Npy5r A G 8: 67,134,404 (GRCm39) F130L probably damaging Het
Nt5c3 T C 6: 56,860,027 (GRCm39) E304G probably benign Het
Odaph A G 5: 92,142,558 (GRCm39) D40G possibly damaging Het
Or2ag13 T A 7: 106,313,649 (GRCm39) K80* probably null Het
Or2y1d C T 11: 49,321,432 (GRCm39) T43I probably benign Het
Or5b3 T C 19: 13,388,182 (GRCm39) M83T probably benign Het
Or8d6 A T 9: 39,854,263 (GRCm39) K236* probably null Het
Palm3 T A 8: 84,756,090 (GRCm39) I534K probably benign Het
Pde10a A G 17: 9,147,964 (GRCm39) N89S probably benign Het
Piezo1 T C 8: 123,223,183 (GRCm39) K870E Het
Pik3c2g T C 6: 139,610,791 (GRCm39) probably null Het
Pnpla6 T A 8: 3,581,737 (GRCm39) Y662* probably null Het
Proser3 A T 7: 30,249,086 (GRCm39) F2Y possibly damaging Het
Psma5 A G 3: 108,172,445 (GRCm39) I54V probably benign Het
Qrich2 C A 11: 116,348,163 (GRCm39) G887V probably damaging Het
Rdx A G 9: 51,977,201 (GRCm39) D150G possibly damaging Het
Reln C T 5: 22,339,690 (GRCm39) V221I probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Samd14 A G 11: 94,914,284 (GRCm39) probably null Het
Scimp A T 11: 70,682,341 (GRCm39) I125N possibly damaging Het
Sec23a A G 12: 59,039,033 (GRCm39) F289L probably damaging Het
Sipa1l3 G A 7: 29,038,571 (GRCm39) Q1408* probably null Het
Skor2 T C 18: 76,946,416 (GRCm39) L46P unknown Het
Slc12a1 A T 2: 125,056,012 (GRCm39) I848F possibly damaging Het
Slc47a1 A G 11: 61,254,229 (GRCm39) L211P probably damaging Het
Slc7a10 T C 7: 34,894,554 (GRCm39) V71A probably damaging Het
Smco1 C A 16: 32,092,865 (GRCm39) Q179K possibly damaging Het
Smg1 A G 7: 117,742,545 (GRCm39) L3223P possibly damaging Het
Smpdl3a T C 10: 57,677,141 (GRCm39) S80P probably damaging Het
Spire2 A G 8: 124,059,726 (GRCm39) R75G probably benign Het
Sptbn2 T A 19: 4,796,827 (GRCm39) H1808Q probably benign Het
Srgap2 T C 1: 131,228,151 (GRCm39) E720G possibly damaging Het
Supv3l1 T C 10: 62,280,860 (GRCm39) D177G probably damaging Het
Syne1 C T 10: 5,214,738 (GRCm39) E3215K probably damaging Het
Szt2 A G 4: 118,231,037 (GRCm39) V2548A unknown Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Washc2 A G 6: 116,203,385 (GRCm39) E384G possibly damaging Het
Zfp712 T A 13: 67,190,249 (GRCm39) N93Y probably benign Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68,110,789 (GRCm39) nonsense probably null
IGL01020:Erbb4 APN 1 68,337,608 (GRCm39) splice site probably benign
IGL01349:Erbb4 APN 1 68,385,752 (GRCm39) missense probably benign 0.00
IGL01386:Erbb4 APN 1 68,383,090 (GRCm39) missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68,367,404 (GRCm39) nonsense probably null
IGL01536:Erbb4 APN 1 68,329,441 (GRCm39) missense probably benign 0.00
IGL01721:Erbb4 APN 1 68,293,722 (GRCm39) missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68,293,725 (GRCm39) missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68,119,885 (GRCm39) missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68,081,694 (GRCm39) missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68,329,453 (GRCm39) missense probably benign 0.00
IGL02399:Erbb4 APN 1 68,081,596 (GRCm39) splice site probably benign
IGL02553:Erbb4 APN 1 68,345,023 (GRCm39) missense probably benign 0.17
IGL03118:Erbb4 APN 1 68,081,878 (GRCm39) missense probably benign 0.11
IGL03329:Erbb4 APN 1 68,367,281 (GRCm39) missense probably benign 0.30
IGL03405:Erbb4 APN 1 68,369,397 (GRCm39) missense probably benign 0.02
earthworm UTSW 1 68,289,739 (GRCm39) missense possibly damaging 0.67
excrescence UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
Mole UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68,110,835 (GRCm39) missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68,114,702 (GRCm39) missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68,083,119 (GRCm39) intron probably benign
R0329:Erbb4 UTSW 1 68,337,439 (GRCm39) splice site probably benign
R0335:Erbb4 UTSW 1 68,298,418 (GRCm39) missense probably benign
R0362:Erbb4 UTSW 1 68,369,429 (GRCm39) missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68,081,621 (GRCm39) missense probably benign 0.17
R0730:Erbb4 UTSW 1 68,298,449 (GRCm39) missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68,348,773 (GRCm39) missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68,293,759 (GRCm39) missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68,599,841 (GRCm39) missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68,599,841 (GRCm39) missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68,385,705 (GRCm39) missense probably benign 0.00
R1523:Erbb4 UTSW 1 68,435,411 (GRCm39) missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68,117,741 (GRCm39) nonsense probably null
R1604:Erbb4 UTSW 1 68,385,728 (GRCm39) missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68,079,547 (GRCm39) missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68,370,393 (GRCm39) missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68,114,569 (GRCm39) splice site probably benign
R1929:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68,337,482 (GRCm39) missense probably benign 0.02
R2139:Erbb4 UTSW 1 68,385,788 (GRCm39) missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68,081,690 (GRCm39) missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68,117,755 (GRCm39) missense probably benign 0.00
R3821:Erbb4 UTSW 1 68,345,072 (GRCm39) missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68,779,560 (GRCm39) missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68,079,496 (GRCm39) missense probably benign 0.07
R4196:Erbb4 UTSW 1 68,383,014 (GRCm39) missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68,385,781 (GRCm39) missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68,383,080 (GRCm39) nonsense probably null
R4642:Erbb4 UTSW 1 68,289,791 (GRCm39) missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68,337,473 (GRCm39) missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68,293,703 (GRCm39) missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68,369,397 (GRCm39) missense probably benign 0.02
R5068:Erbb4 UTSW 1 68,083,061 (GRCm39) splice site probably null
R5546:Erbb4 UTSW 1 68,337,452 (GRCm39) missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68,599,678 (GRCm39) missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68,083,075 (GRCm39) missense probably benign
R6257:Erbb4 UTSW 1 68,435,432 (GRCm39) missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68,081,689 (GRCm39) missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68,409,662 (GRCm39) missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68,079,462 (GRCm39) missense probably benign 0.00
R7087:Erbb4 UTSW 1 68,779,650 (GRCm39) missense probably null 1.00
R7215:Erbb4 UTSW 1 68,378,619 (GRCm39) missense probably benign
R7356:Erbb4 UTSW 1 68,378,514 (GRCm39) critical splice donor site probably null
R7509:Erbb4 UTSW 1 68,289,739 (GRCm39) missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68,293,758 (GRCm39) missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68,367,278 (GRCm39) missense probably benign 0.00
R7784:Erbb4 UTSW 1 68,114,658 (GRCm39) missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68,081,885 (GRCm39) missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68,435,470 (GRCm39) missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68,337,509 (GRCm39) missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68,348,785 (GRCm39) missense probably benign
R8783:Erbb4 UTSW 1 68,079,331 (GRCm39) missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68,114,627 (GRCm39) missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68,382,997 (GRCm39) critical splice donor site probably null
R9053:Erbb4 UTSW 1 68,289,779 (GRCm39) missense possibly damaging 0.63
R9142:Erbb4 UTSW 1 68,388,552 (GRCm39) missense probably damaging 1.00
R9237:Erbb4 UTSW 1 68,081,601 (GRCm39) missense possibly damaging 0.72
R9350:Erbb4 UTSW 1 68,329,638 (GRCm39) missense probably benign 0.00
R9374:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9434:Erbb4 UTSW 1 68,081,773 (GRCm39) missense possibly damaging 0.84
R9499:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9551:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9753:Erbb4 UTSW 1 68,238,062 (GRCm39) missense probably benign 0.00
X0019:Erbb4 UTSW 1 68,112,304 (GRCm39) missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68,367,418 (GRCm39) nonsense probably null
Z1176:Erbb4 UTSW 1 68,337,561 (GRCm39) frame shift probably null
Z1177:Erbb4 UTSW 1 68,348,802 (GRCm39) missense probably benign 0.06
Z1177:Erbb4 UTSW 1 68,329,635 (GRCm39) missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68,298,342 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAAACAGAGCATCATCTAGCTG -3'
(R):5'- AGTGTGGAAATTGCCTCATGC -3'

Sequencing Primer
(F):5'- CTTTATATGCCCCAGTACAGGAG -3'
(R):5'- GCCTCATGCAGCTGCTTTTTC -3'
Posted On 2020-09-15