Incidental Mutation 'R7923:Myh7b'
ID 648508
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Name myosin, heavy chain 7B, cardiac muscle, beta
Synonyms Myh14
MMRRC Submission 045970-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7923 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 155453132-155476227 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 155467886 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 808 (Y808F)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092995]
AlphaFold A2AQP0
Predicted Effect probably benign
Transcript: ENSMUST00000092995
AA Change: Y808F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: Y808F

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C T 8: 73,198,755 (GRCm39) T54M probably damaging Het
Aacs T A 5: 125,588,948 (GRCm39) S409T probably damaging Het
Atf6 T C 1: 170,622,275 (GRCm39) M449V probably benign Het
B4galt1 C T 4: 40,809,373 (GRCm39) G332S probably benign Het
Bcl11a G T 11: 24,113,680 (GRCm39) R341M probably damaging Het
Brf2 G A 8: 27,614,218 (GRCm39) Q323* probably null Het
Bscl2 T C 19: 8,824,883 (GRCm39) V322A probably benign Het
Btnl9 T C 11: 49,071,565 (GRCm39) Y86C probably damaging Het
C4b T A 17: 34,961,354 (GRCm39) I202F probably damaging Het
Cbfb T A 8: 105,921,225 (GRCm39) probably null Het
Cc2d2b T A 19: 40,795,293 (GRCm39) Y963N possibly damaging Het
Cep135 A T 5: 76,757,539 (GRCm39) D391V possibly damaging Het
Cfap97d2 A C 8: 13,788,456 (GRCm39) H140P unknown Het
Col12a1 A G 9: 79,585,775 (GRCm39) V1228A probably benign Het
Cr2 T A 1: 194,850,995 (GRCm39) Y157F probably benign Het
Creg2 C T 1: 39,690,071 (GRCm39) G13E probably benign Het
Cul5 G T 9: 53,535,466 (GRCm39) A595E probably benign Het
Cyp4f16 A G 17: 32,765,721 (GRCm39) E368G possibly damaging Het
Dhrs7l G T 12: 72,666,132 (GRCm39) Q180K probably benign Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,739,935 (GRCm39) probably benign Het
Eps15 G A 4: 109,173,069 (GRCm39) D177N possibly damaging Het
Erbb4 C T 1: 68,298,368 (GRCm39) R684H probably damaging Het
Ermp1 C T 19: 29,606,058 (GRCm39) V419I probably benign Het
Foxi3 T C 6: 70,937,700 (GRCm39) S311P probably benign Het
Fras1 C T 5: 96,887,177 (GRCm39) A2653V probably damaging Het
Gbp3 A T 3: 142,273,373 (GRCm39) N307Y probably damaging Het
Ggcx G A 6: 72,404,900 (GRCm39) R436Q probably damaging Het
Gimap3 A T 6: 48,742,561 (GRCm39) V123D probably benign Het
Gm14326 A T 2: 177,587,680 (GRCm39) Y439N probably damaging Het
Gm5591 A G 7: 38,221,338 (GRCm39) S244P probably benign Het
Gm9507 A T 10: 77,647,371 (GRCm39) C103S unknown Het
Guf1 G A 5: 69,718,502 (GRCm39) V214I probably benign Het
Ido2 T C 8: 25,066,209 (GRCm39) Y19C probably damaging Het
Idua T C 5: 108,828,449 (GRCm39) S268P probably damaging Het
Igf1r T C 7: 67,839,849 (GRCm39) Y719H probably damaging Het
Itgb4 A T 11: 115,873,525 (GRCm39) probably null Het
Itprid2 G T 2: 79,492,959 (GRCm39) E1169* probably null Het
Kctd19 T A 8: 106,111,690 (GRCm39) T868S probably damaging Het
Lonrf2 A T 1: 38,839,843 (GRCm39) H417Q probably benign Het
Lrp2 T C 2: 69,268,732 (GRCm39) T4184A possibly damaging Het
Mapk15 T C 15: 75,868,295 (GRCm39) F219S probably damaging Het
Myo19 T G 11: 84,776,536 (GRCm39) F64C possibly damaging Het
Mysm1 A T 4: 94,850,002 (GRCm39) V434D probably damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 67,313,200 (GRCm39) probably benign Het
Nbeal2 A T 9: 110,460,514 (GRCm39) Y1780* probably null Het
Ndc80 A T 17: 71,803,296 (GRCm39) M615K probably benign Het
Nfkbib C A 7: 28,465,688 (GRCm39) V54F probably damaging Het
Npy5r A G 8: 67,134,404 (GRCm39) F130L probably damaging Het
Nt5c3 T C 6: 56,860,027 (GRCm39) E304G probably benign Het
Odaph A G 5: 92,142,558 (GRCm39) D40G possibly damaging Het
Or2ag13 T A 7: 106,313,649 (GRCm39) K80* probably null Het
Or2y1d C T 11: 49,321,432 (GRCm39) T43I probably benign Het
Or5b3 T C 19: 13,388,182 (GRCm39) M83T probably benign Het
Or8d6 A T 9: 39,854,263 (GRCm39) K236* probably null Het
Palm3 T A 8: 84,756,090 (GRCm39) I534K probably benign Het
Pde10a A G 17: 9,147,964 (GRCm39) N89S probably benign Het
Piezo1 T C 8: 123,223,183 (GRCm39) K870E Het
Pik3c2g T C 6: 139,610,791 (GRCm39) probably null Het
Pnpla6 T A 8: 3,581,737 (GRCm39) Y662* probably null Het
Proser3 A T 7: 30,249,086 (GRCm39) F2Y possibly damaging Het
Psma5 A G 3: 108,172,445 (GRCm39) I54V probably benign Het
Qrich2 C A 11: 116,348,163 (GRCm39) G887V probably damaging Het
Rdx A G 9: 51,977,201 (GRCm39) D150G possibly damaging Het
Reln C T 5: 22,339,690 (GRCm39) V221I probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Samd14 A G 11: 94,914,284 (GRCm39) probably null Het
Scimp A T 11: 70,682,341 (GRCm39) I125N possibly damaging Het
Sec23a A G 12: 59,039,033 (GRCm39) F289L probably damaging Het
Sipa1l3 G A 7: 29,038,571 (GRCm39) Q1408* probably null Het
Skor2 T C 18: 76,946,416 (GRCm39) L46P unknown Het
Slc12a1 A T 2: 125,056,012 (GRCm39) I848F possibly damaging Het
Slc47a1 A G 11: 61,254,229 (GRCm39) L211P probably damaging Het
Slc7a10 T C 7: 34,894,554 (GRCm39) V71A probably damaging Het
Smco1 C A 16: 32,092,865 (GRCm39) Q179K possibly damaging Het
Smg1 A G 7: 117,742,545 (GRCm39) L3223P possibly damaging Het
Smpdl3a T C 10: 57,677,141 (GRCm39) S80P probably damaging Het
Spire2 A G 8: 124,059,726 (GRCm39) R75G probably benign Het
Sptbn2 T A 19: 4,796,827 (GRCm39) H1808Q probably benign Het
Srgap2 T C 1: 131,228,151 (GRCm39) E720G possibly damaging Het
Supv3l1 T C 10: 62,280,860 (GRCm39) D177G probably damaging Het
Syne1 C T 10: 5,214,738 (GRCm39) E3215K probably damaging Het
Szt2 A G 4: 118,231,037 (GRCm39) V2548A unknown Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Washc2 A G 6: 116,203,385 (GRCm39) E384G possibly damaging Het
Zfp712 T A 13: 67,190,249 (GRCm39) N93Y probably benign Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155,472,212 (GRCm39) missense probably damaging 0.99
IGL01604:Myh7b APN 2 155,474,327 (GRCm39) missense probably damaging 0.96
IGL02179:Myh7b APN 2 155,456,411 (GRCm39) missense probably benign 0.02
IGL02729:Myh7b APN 2 155,467,609 (GRCm39) missense probably damaging 1.00
IGL02804:Myh7b APN 2 155,467,643 (GRCm39) missense probably damaging 1.00
IGL02851:Myh7b APN 2 155,470,747 (GRCm39) missense probably damaging 1.00
IGL02956:Myh7b APN 2 155,467,874 (GRCm39) missense possibly damaging 0.95
IGL02956:Myh7b APN 2 155,474,823 (GRCm39) missense probably damaging 1.00
IGL02992:Myh7b APN 2 155,463,330 (GRCm39) missense probably damaging 0.99
IGL03060:Myh7b APN 2 155,474,671 (GRCm39) missense probably damaging 1.00
IGL03061:Myh7b APN 2 155,462,031 (GRCm39) missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155,462,403 (GRCm39) nonsense probably null
IGL03246:Myh7b APN 2 155,459,792 (GRCm39) missense probably damaging 1.00
IGL03382:Myh7b APN 2 155,465,399 (GRCm39) missense probably damaging 1.00
euclidian UTSW 2 155,475,319 (GRCm39) missense probably benign 0.32
imaginary UTSW 2 155,474,175 (GRCm39) missense probably benign 0.36
Irrational UTSW 2 155,472,592 (GRCm39) unclassified probably benign
Muscoli UTSW 2 155,462,038 (GRCm39) nonsense probably null
R0015:Myh7b UTSW 2 155,464,206 (GRCm39) missense probably damaging 1.00
R0015:Myh7b UTSW 2 155,464,206 (GRCm39) missense probably damaging 1.00
R0109:Myh7b UTSW 2 155,453,594 (GRCm39) missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155,472,592 (GRCm39) unclassified probably benign
R0567:Myh7b UTSW 2 155,468,318 (GRCm39) missense probably damaging 1.00
R0619:Myh7b UTSW 2 155,453,642 (GRCm39) missense probably benign 0.00
R0927:Myh7b UTSW 2 155,462,040 (GRCm39) missense probably damaging 1.00
R0973:Myh7b UTSW 2 155,462,347 (GRCm39) missense probably benign
R0973:Myh7b UTSW 2 155,462,347 (GRCm39) missense probably benign
R0974:Myh7b UTSW 2 155,462,347 (GRCm39) missense probably benign
R1137:Myh7b UTSW 2 155,464,634 (GRCm39) missense probably damaging 1.00
R1261:Myh7b UTSW 2 155,463,003 (GRCm39) missense probably benign 0.00
R1268:Myh7b UTSW 2 155,455,966 (GRCm39) nonsense probably null
R1537:Myh7b UTSW 2 155,473,707 (GRCm39) missense probably damaging 0.96
R1632:Myh7b UTSW 2 155,462,445 (GRCm39) missense probably benign 0.04
R1694:Myh7b UTSW 2 155,455,113 (GRCm39) missense probably damaging 0.99
R1697:Myh7b UTSW 2 155,462,054 (GRCm39) missense probably damaging 1.00
R1730:Myh7b UTSW 2 155,467,592 (GRCm39) missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155,472,778 (GRCm39) missense probably damaging 0.96
R1783:Myh7b UTSW 2 155,467,592 (GRCm39) missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155,471,377 (GRCm39) missense probably benign 0.00
R2140:Myh7b UTSW 2 155,462,043 (GRCm39) missense probably damaging 1.00
R2971:Myh7b UTSW 2 155,474,175 (GRCm39) missense probably benign 0.36
R3838:Myh7b UTSW 2 155,474,909 (GRCm39) missense probably damaging 1.00
R4074:Myh7b UTSW 2 155,460,678 (GRCm39) missense probably damaging 0.96
R4191:Myh7b UTSW 2 155,475,319 (GRCm39) missense probably benign 0.32
R4689:Myh7b UTSW 2 155,472,434 (GRCm39) missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155,456,097 (GRCm39) missense probably damaging 1.00
R4697:Myh7b UTSW 2 155,471,242 (GRCm39) missense probably damaging 1.00
R4771:Myh7b UTSW 2 155,468,314 (GRCm39) nonsense probably null
R4794:Myh7b UTSW 2 155,465,186 (GRCm39) missense probably benign 0.00
R4842:Myh7b UTSW 2 155,475,909 (GRCm39) missense probably benign 0.45
R4871:Myh7b UTSW 2 155,455,420 (GRCm39) missense probably benign 0.18
R5022:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155,473,670 (GRCm39) missense probably benign 0.00
R5055:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155,474,234 (GRCm39) missense probably benign
R5422:Myh7b UTSW 2 155,472,954 (GRCm39) missense probably damaging 0.99
R5505:Myh7b UTSW 2 155,474,592 (GRCm39) missense probably benign 0.01
R5946:Myh7b UTSW 2 155,463,315 (GRCm39) missense probably damaging 1.00
R6089:Myh7b UTSW 2 155,464,409 (GRCm39) missense probably damaging 1.00
R6103:Myh7b UTSW 2 155,460,663 (GRCm39) missense probably damaging 1.00
R6233:Myh7b UTSW 2 155,473,719 (GRCm39) missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155,474,316 (GRCm39) missense probably damaging 1.00
R6350:Myh7b UTSW 2 155,470,680 (GRCm39) missense probably benign 0.00
R6484:Myh7b UTSW 2 155,470,563 (GRCm39) missense probably benign 0.05
R6760:Myh7b UTSW 2 155,462,038 (GRCm39) nonsense probably null
R6896:Myh7b UTSW 2 155,464,488 (GRCm39) critical splice donor site probably null
R6945:Myh7b UTSW 2 155,464,152 (GRCm39) missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155,473,671 (GRCm39) missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155,456,053 (GRCm39) missense probably damaging 1.00
R7102:Myh7b UTSW 2 155,464,119 (GRCm39) missense probably damaging 1.00
R7248:Myh7b UTSW 2 155,464,106 (GRCm39) missense probably damaging 1.00
R7303:Myh7b UTSW 2 155,460,660 (GRCm39) missense probably damaging 1.00
R7360:Myh7b UTSW 2 155,474,460 (GRCm39) missense probably benign 0.38
R7652:Myh7b UTSW 2 155,474,156 (GRCm39) missense probably damaging 0.99
R7678:Myh7b UTSW 2 155,459,698 (GRCm39) splice site probably null
R7703:Myh7b UTSW 2 155,462,356 (GRCm39) missense probably null 1.00
R7711:Myh7b UTSW 2 155,462,323 (GRCm39) missense probably damaging 1.00
R7967:Myh7b UTSW 2 155,456,119 (GRCm39) splice site probably null
R8045:Myh7b UTSW 2 155,455,101 (GRCm39) missense probably benign 0.00
R8176:Myh7b UTSW 2 155,467,886 (GRCm39) missense probably benign 0.06
R8272:Myh7b UTSW 2 155,474,824 (GRCm39) missense probably damaging 1.00
R8560:Myh7b UTSW 2 155,465,124 (GRCm39) missense possibly damaging 0.93
R8706:Myh7b UTSW 2 155,453,669 (GRCm39) critical splice donor site probably null
R8824:Myh7b UTSW 2 155,472,301 (GRCm39) missense probably benign 0.02
R8832:Myh7b UTSW 2 155,475,182 (GRCm39) missense probably benign 0.00
R9079:Myh7b UTSW 2 155,465,174 (GRCm39) missense probably damaging 0.97
R9151:Myh7b UTSW 2 155,474,439 (GRCm39) missense probably damaging 1.00
R9311:Myh7b UTSW 2 155,463,253 (GRCm39) missense probably damaging 1.00
R9332:Myh7b UTSW 2 155,470,722 (GRCm39) missense probably damaging 1.00
R9357:Myh7b UTSW 2 155,463,268 (GRCm39) missense probably damaging 1.00
R9388:Myh7b UTSW 2 155,472,983 (GRCm39) missense probably benign 0.28
R9583:Myh7b UTSW 2 155,459,641 (GRCm39) missense probably damaging 1.00
R9657:Myh7b UTSW 2 155,455,963 (GRCm39) missense probably damaging 1.00
R9738:Myh7b UTSW 2 155,455,963 (GRCm39) missense probably damaging 1.00
X0013:Myh7b UTSW 2 155,473,089 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTATCAGTTTGGCCACACC -3'
(R):5'- GTAAAATCCGAGGCTAGGCG -3'

Sequencing Primer
(F):5'- CCGGAGTTAGGGCTTAACCTG -3'
(R):5'- CGAGGCTAGGCGAGACAC -3'
Posted On 2020-09-15