Incidental Mutation 'R7923:Gm14326'
ID648509
Institutional Source Beutler Lab
Gene Symbol Gm14326
Ensembl Gene ENSMUSG00000078862
Gene Namepredicted gene 14326
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R7923 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location177935993-177957297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 177945887 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 439 (Y439N)
Ref Sequence ENSEMBL: ENSMUSP00000104558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108928] [ENSMUST00000108930] [ENSMUST00000108932] [ENSMUST00000178829]
Predicted Effect probably benign
Transcript: ENSMUST00000108928
SMART Domains Protein: ENSMUSP00000104556
Gene: ENSMUSG00000078862

DomainStartEndE-ValueType
KRAB 4 64 1.37e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108930
AA Change: Y439N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104558
Gene: ENSMUSG00000078862
AA Change: Y439N

DomainStartEndE-ValueType
KRAB 4 66 1.84e-13 SMART
ZnF_C2H2 78 97 1.61e2 SMART
ZnF_C2H2 103 125 4.17e-3 SMART
ZnF_C2H2 131 153 3.34e-2 SMART
ZnF_C2H2 159 181 5.29e-5 SMART
ZnF_C2H2 187 209 6.08e-5 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 241 265 3.99e0 SMART
ZnF_C2H2 271 293 3.83e-2 SMART
ZnF_C2H2 299 321 5.14e-3 SMART
ZnF_C2H2 327 349 5.14e-3 SMART
ZnF_C2H2 355 377 9.08e-4 SMART
ZnF_C2H2 383 405 1.69e-3 SMART
ZnF_C2H2 411 433 7.37e-4 SMART
ZnF_C2H2 439 461 9.08e-4 SMART
ZnF_C2H2 467 489 4.24e-4 SMART
ZnF_C2H2 495 517 4.94e-5 SMART
ZnF_C2H2 523 545 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108932
SMART Domains Protein: ENSMUSP00000104560
Gene: ENSMUSG00000078862

DomainStartEndE-ValueType
KRAB 4 66 2.43e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178829
AA Change: Y439N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137615
Gene: ENSMUSG00000078862
AA Change: Y439N

DomainStartEndE-ValueType
KRAB 4 66 1.84e-13 SMART
ZnF_C2H2 78 97 1.61e2 SMART
ZnF_C2H2 103 125 4.17e-3 SMART
ZnF_C2H2 131 153 3.34e-2 SMART
ZnF_C2H2 159 181 5.29e-5 SMART
ZnF_C2H2 187 209 6.08e-5 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 241 265 3.99e0 SMART
ZnF_C2H2 271 293 3.83e-2 SMART
ZnF_C2H2 299 321 5.14e-3 SMART
ZnF_C2H2 327 349 5.14e-3 SMART
ZnF_C2H2 355 377 9.08e-4 SMART
ZnF_C2H2 383 405 1.69e-3 SMART
ZnF_C2H2 411 433 7.37e-4 SMART
ZnF_C2H2 439 461 9.08e-4 SMART
ZnF_C2H2 467 489 4.24e-4 SMART
ZnF_C2H2 495 517 4.94e-5 SMART
ZnF_C2H2 523 545 1.12e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C T 8: 72,444,911 T54M probably damaging Het
4932443I19Rik A C 8: 13,738,456 H140P unknown Het
Aacs T A 5: 125,511,884 S409T probably damaging Het
Atf6 T C 1: 170,794,706 M449V probably benign Het
B4galt1 C T 4: 40,809,373 G332S probably benign Het
Bcl11a G T 11: 24,163,680 R341M probably damaging Het
Brf2 G A 8: 27,124,190 Q323* probably null Het
Bscl2 T C 19: 8,847,519 V322A probably benign Het
Btnl9 T C 11: 49,180,738 Y86C probably damaging Het
C4b T A 17: 34,742,380 I202F probably damaging Het
Cbfb T A 8: 105,194,593 probably null Het
Cc2d2b T A 19: 40,806,849 Y963N possibly damaging Het
Cep135 A T 5: 76,609,692 D391V possibly damaging Het
Col12a1 A G 9: 79,678,493 V1228A probably benign Het
Cr2 T A 1: 195,168,687 Y157F probably benign Het
Creg2 C T 1: 39,650,903 G13E probably benign Het
Cul5 G T 9: 53,624,166 A595E probably benign Het
Cyp4f16 A G 17: 32,546,747 E368G possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Eps15 G A 4: 109,315,872 D177N possibly damaging Het
Erbb4 C T 1: 68,259,209 R684H probably damaging Het
Ermp1 C T 19: 29,628,658 V419I probably benign Het
Foxi3 T C 6: 70,960,716 S311P probably benign Het
Fras1 C T 5: 96,739,318 A2653V probably damaging Het
Gbp3 A T 3: 142,567,612 N307Y probably damaging Het
Ggcx G A 6: 72,427,917 R436Q probably damaging Het
Gimap3 A T 6: 48,765,627 V123D probably benign Het
Gm4756 G T 12: 72,619,358 Q180K probably benign Het
Gm5591 A G 7: 38,521,914 S244P probably benign Het
Gm9507 A T 10: 77,811,537 C103S unknown Het
Guf1 G A 5: 69,561,159 V214I probably benign Het
Ido2 T C 8: 24,576,193 Y19C probably damaging Het
Idua T C 5: 108,680,583 S268P probably damaging Het
Igf1r T C 7: 68,190,101 Y719H probably damaging Het
Itgb4 A T 11: 115,982,699 probably null Het
Kctd19 T A 8: 105,385,058 T868S probably damaging Het
Lonrf2 A T 1: 38,800,762 H417Q probably benign Het
Lrp2 T C 2: 69,438,388 T4184A possibly damaging Het
Mapk15 T C 15: 75,996,446 F219S probably damaging Het
Myh7b A T 2: 155,625,966 Y808F probably benign Het
Myo19 T G 11: 84,885,710 F64C possibly damaging Het
Mysm1 A T 4: 94,961,765 V434D probably damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nbeal2 A T 9: 110,631,446 Y1780* probably null Het
Ndc80 A T 17: 71,496,301 M615K probably benign Het
Nfkbib C A 7: 28,766,263 V54F probably damaging Het
Npy5r A G 8: 66,681,752 F130L probably damaging Het
Nt5c3 T C 6: 56,883,042 E304G probably benign Het
Odaph A G 5: 91,994,699 D40G possibly damaging Het
Olfr1389 C T 11: 49,430,605 T43I probably benign Het
Olfr1469 T C 19: 13,410,818 M83T probably benign Het
Olfr695 T A 7: 106,714,442 K80* probably null Het
Olfr974 A T 9: 39,942,967 K236* probably null Het
Palm3 T A 8: 84,029,461 I534K probably benign Het
Pde10a A G 17: 8,929,132 N89S probably benign Het
Piezo1 T C 8: 122,496,444 K870E Het
Pik3c2g T C 6: 139,633,793 probably null Het
Pnpla6 T A 8: 3,531,737 Y662* probably null Het
Proser3 A T 7: 30,549,661 F2Y possibly damaging Het
Psma5 A G 3: 108,265,129 I54V probably benign Het
Qrich2 C A 11: 116,457,337 G887V probably damaging Het
Rdx A G 9: 52,065,901 D150G possibly damaging Het
Reln C T 5: 22,134,692 V221I probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Samd14 A G 11: 95,023,458 probably null Het
Scimp A T 11: 70,791,515 I125N possibly damaging Het
Sec23a A G 12: 58,992,247 F289L probably damaging Het
Sipa1l3 G A 7: 29,339,146 Q1408* probably null Het
Skor2 T C 18: 76,858,721 L46P unknown Het
Slc12a1 A T 2: 125,214,092 I848F possibly damaging Het
Slc47a1 A G 11: 61,363,403 L211P probably damaging Het
Slc7a10 T C 7: 35,195,129 V71A probably damaging Het
Smco1 C A 16: 32,274,047 Q179K possibly damaging Het
Smg1 A G 7: 118,143,322 L3223P possibly damaging Het
Smpdl3a T C 10: 57,801,045 S80P probably damaging Het
Spire2 A G 8: 123,332,987 R75G probably benign Het
Sptbn2 T A 19: 4,746,799 H1808Q probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Ssfa2 G T 2: 79,662,615 E1169* probably null Het
Supv3l1 T C 10: 62,445,081 D177G probably damaging Het
Syne1 C T 10: 5,264,738 E3215K probably damaging Het
Szt2 A G 4: 118,373,840 V2548A unknown Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Washc2 A G 6: 116,226,424 E384G possibly damaging Het
Zfp712 T A 13: 67,042,185 N93Y probably benign Het
Other mutations in Gm14326
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Gm14326 APN 2 177945698 missense probably damaging 1.00
R3912:Gm14326 UTSW 2 177945865 missense probably damaging 1.00
R6080:Gm14326 UTSW 2 177936546 missense probably benign
R7089:Gm14326 UTSW 2 177946671 missense probably damaging 1.00
R7509:Gm14326 UTSW 2 177945700 missense probably benign 0.17
R7526:Gm14326 UTSW 2 177946505 missense probably damaging 1.00
R7682:Gm14326 UTSW 2 177948481 missense probably damaging 0.96
R8356:Gm14326 UTSW 2 177948519 missense probably benign 0.00
R8456:Gm14326 UTSW 2 177948519 missense probably benign 0.00
R8543:Gm14326 UTSW 2 177945659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGCAAAGGCTTTACCATA -3'
(R):5'- GCCTTTTCACAAAGCAGACATCT -3'

Sequencing Primer
(F):5'- GCGAAGGCTTTACCACATTG -3'
(R):5'- GCAGACATCTCCGAATACATAAGCG -3'
Posted On2020-09-15