Incidental Mutation 'R7923:Szt2'
ID 648515
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name SZT2 subunit of KICSTOR complex
Synonyms seaizure threshold 2
MMRRC Submission 045970-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.610) question?
Stock # R7923 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 118219940-118266470 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118231037 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2548 (V2548A)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000075406
AA Change: V2548A
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: V2548A

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C T 8: 73,198,755 (GRCm39) T54M probably damaging Het
Aacs T A 5: 125,588,948 (GRCm39) S409T probably damaging Het
Atf6 T C 1: 170,622,275 (GRCm39) M449V probably benign Het
B4galt1 C T 4: 40,809,373 (GRCm39) G332S probably benign Het
Bcl11a G T 11: 24,113,680 (GRCm39) R341M probably damaging Het
Brf2 G A 8: 27,614,218 (GRCm39) Q323* probably null Het
Bscl2 T C 19: 8,824,883 (GRCm39) V322A probably benign Het
Btnl9 T C 11: 49,071,565 (GRCm39) Y86C probably damaging Het
C4b T A 17: 34,961,354 (GRCm39) I202F probably damaging Het
Cbfb T A 8: 105,921,225 (GRCm39) probably null Het
Cc2d2b T A 19: 40,795,293 (GRCm39) Y963N possibly damaging Het
Cep135 A T 5: 76,757,539 (GRCm39) D391V possibly damaging Het
Cfap97d2 A C 8: 13,788,456 (GRCm39) H140P unknown Het
Col12a1 A G 9: 79,585,775 (GRCm39) V1228A probably benign Het
Cr2 T A 1: 194,850,995 (GRCm39) Y157F probably benign Het
Creg2 C T 1: 39,690,071 (GRCm39) G13E probably benign Het
Cul5 G T 9: 53,535,466 (GRCm39) A595E probably benign Het
Cyp4f16 A G 17: 32,765,721 (GRCm39) E368G possibly damaging Het
Dhrs7l G T 12: 72,666,132 (GRCm39) Q180K probably benign Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,739,935 (GRCm39) probably benign Het
Eps15 G A 4: 109,173,069 (GRCm39) D177N possibly damaging Het
Erbb4 C T 1: 68,298,368 (GRCm39) R684H probably damaging Het
Ermp1 C T 19: 29,606,058 (GRCm39) V419I probably benign Het
Foxi3 T C 6: 70,937,700 (GRCm39) S311P probably benign Het
Fras1 C T 5: 96,887,177 (GRCm39) A2653V probably damaging Het
Gbp3 A T 3: 142,273,373 (GRCm39) N307Y probably damaging Het
Ggcx G A 6: 72,404,900 (GRCm39) R436Q probably damaging Het
Gimap3 A T 6: 48,742,561 (GRCm39) V123D probably benign Het
Gm14326 A T 2: 177,587,680 (GRCm39) Y439N probably damaging Het
Gm5591 A G 7: 38,221,338 (GRCm39) S244P probably benign Het
Gm9507 A T 10: 77,647,371 (GRCm39) C103S unknown Het
Guf1 G A 5: 69,718,502 (GRCm39) V214I probably benign Het
Ido2 T C 8: 25,066,209 (GRCm39) Y19C probably damaging Het
Idua T C 5: 108,828,449 (GRCm39) S268P probably damaging Het
Igf1r T C 7: 67,839,849 (GRCm39) Y719H probably damaging Het
Itgb4 A T 11: 115,873,525 (GRCm39) probably null Het
Itprid2 G T 2: 79,492,959 (GRCm39) E1169* probably null Het
Kctd19 T A 8: 106,111,690 (GRCm39) T868S probably damaging Het
Lonrf2 A T 1: 38,839,843 (GRCm39) H417Q probably benign Het
Lrp2 T C 2: 69,268,732 (GRCm39) T4184A possibly damaging Het
Mapk15 T C 15: 75,868,295 (GRCm39) F219S probably damaging Het
Myh7b A T 2: 155,467,886 (GRCm39) Y808F probably benign Het
Myo19 T G 11: 84,776,536 (GRCm39) F64C possibly damaging Het
Mysm1 A T 4: 94,850,002 (GRCm39) V434D probably damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 67,313,200 (GRCm39) probably benign Het
Nbeal2 A T 9: 110,460,514 (GRCm39) Y1780* probably null Het
Ndc80 A T 17: 71,803,296 (GRCm39) M615K probably benign Het
Nfkbib C A 7: 28,465,688 (GRCm39) V54F probably damaging Het
Npy5r A G 8: 67,134,404 (GRCm39) F130L probably damaging Het
Nt5c3 T C 6: 56,860,027 (GRCm39) E304G probably benign Het
Odaph A G 5: 92,142,558 (GRCm39) D40G possibly damaging Het
Or2ag13 T A 7: 106,313,649 (GRCm39) K80* probably null Het
Or2y1d C T 11: 49,321,432 (GRCm39) T43I probably benign Het
Or5b3 T C 19: 13,388,182 (GRCm39) M83T probably benign Het
Or8d6 A T 9: 39,854,263 (GRCm39) K236* probably null Het
Palm3 T A 8: 84,756,090 (GRCm39) I534K probably benign Het
Pde10a A G 17: 9,147,964 (GRCm39) N89S probably benign Het
Piezo1 T C 8: 123,223,183 (GRCm39) K870E Het
Pik3c2g T C 6: 139,610,791 (GRCm39) probably null Het
Pnpla6 T A 8: 3,581,737 (GRCm39) Y662* probably null Het
Proser3 A T 7: 30,249,086 (GRCm39) F2Y possibly damaging Het
Psma5 A G 3: 108,172,445 (GRCm39) I54V probably benign Het
Qrich2 C A 11: 116,348,163 (GRCm39) G887V probably damaging Het
Rdx A G 9: 51,977,201 (GRCm39) D150G possibly damaging Het
Reln C T 5: 22,339,690 (GRCm39) V221I probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Samd14 A G 11: 94,914,284 (GRCm39) probably null Het
Scimp A T 11: 70,682,341 (GRCm39) I125N possibly damaging Het
Sec23a A G 12: 59,039,033 (GRCm39) F289L probably damaging Het
Sipa1l3 G A 7: 29,038,571 (GRCm39) Q1408* probably null Het
Skor2 T C 18: 76,946,416 (GRCm39) L46P unknown Het
Slc12a1 A T 2: 125,056,012 (GRCm39) I848F possibly damaging Het
Slc47a1 A G 11: 61,254,229 (GRCm39) L211P probably damaging Het
Slc7a10 T C 7: 34,894,554 (GRCm39) V71A probably damaging Het
Smco1 C A 16: 32,092,865 (GRCm39) Q179K possibly damaging Het
Smg1 A G 7: 117,742,545 (GRCm39) L3223P possibly damaging Het
Smpdl3a T C 10: 57,677,141 (GRCm39) S80P probably damaging Het
Spire2 A G 8: 124,059,726 (GRCm39) R75G probably benign Het
Sptbn2 T A 19: 4,796,827 (GRCm39) H1808Q probably benign Het
Srgap2 T C 1: 131,228,151 (GRCm39) E720G possibly damaging Het
Supv3l1 T C 10: 62,280,860 (GRCm39) D177G probably damaging Het
Syne1 C T 10: 5,214,738 (GRCm39) E3215K probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Washc2 A G 6: 116,203,385 (GRCm39) E384G possibly damaging Het
Zfp712 T A 13: 67,190,249 (GRCm39) N93Y probably benign Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118,241,447 (GRCm39) splice site probably benign
IGL01082:Szt2 APN 4 118,254,821 (GRCm39) missense probably damaging 1.00
IGL01348:Szt2 APN 4 118,250,821 (GRCm39) splice site probably benign
IGL01869:Szt2 APN 4 118,256,268 (GRCm39) missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118,241,450 (GRCm39) splice site probably benign
IGL01951:Szt2 APN 4 118,233,690 (GRCm39) unclassified probably benign
IGL01971:Szt2 APN 4 118,244,152 (GRCm39) missense probably benign 0.01
IGL02047:Szt2 APN 4 118,233,834 (GRCm39) unclassified probably benign
IGL02092:Szt2 APN 4 118,220,529 (GRCm39) unclassified probably benign
IGL02120:Szt2 APN 4 118,245,761 (GRCm39) missense probably benign 0.01
IGL02210:Szt2 APN 4 118,247,020 (GRCm39) missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118,248,020 (GRCm39) missense probably damaging 1.00
IGL02622:Szt2 APN 4 118,250,087 (GRCm39) missense probably damaging 0.96
IGL02666:Szt2 APN 4 118,231,252 (GRCm39) missense probably damaging 0.99
IGL02712:Szt2 APN 4 118,242,030 (GRCm39) missense probably benign 0.19
IGL02983:Szt2 APN 4 118,222,976 (GRCm39) unclassified probably benign
IGL03026:Szt2 APN 4 118,249,046 (GRCm39) missense probably benign 0.40
IGL03178:Szt2 APN 4 118,239,886 (GRCm39) missense unknown
IGL03233:Szt2 APN 4 118,229,726 (GRCm39) missense unknown
IGL03377:Szt2 APN 4 118,259,594 (GRCm39) splice site probably benign
IGL03387:Szt2 APN 4 118,221,922 (GRCm39) unclassified probably benign
PIT4687001:Szt2 UTSW 4 118,255,398 (GRCm39) missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118,241,969 (GRCm39) missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118,239,790 (GRCm39) missense unknown
R0396:Szt2 UTSW 4 118,233,544 (GRCm39) unclassified probably benign
R0504:Szt2 UTSW 4 118,230,149 (GRCm39) splice site probably null
R1033:Szt2 UTSW 4 118,244,303 (GRCm39) missense probably damaging 0.98
R1222:Szt2 UTSW 4 118,262,656 (GRCm39) missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118,244,976 (GRCm39) missense probably benign 0.03
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1763:Szt2 UTSW 4 118,229,565 (GRCm39) missense unknown
R1772:Szt2 UTSW 4 118,262,714 (GRCm39) missense probably damaging 1.00
R1840:Szt2 UTSW 4 118,222,854 (GRCm39) unclassified probably benign
R1942:Szt2 UTSW 4 118,249,817 (GRCm39) missense probably benign 0.17
R1965:Szt2 UTSW 4 118,241,162 (GRCm39) missense probably benign 0.36
R1998:Szt2 UTSW 4 118,232,924 (GRCm39) critical splice donor site probably null
R2009:Szt2 UTSW 4 118,235,261 (GRCm39) critical splice donor site probably null
R2012:Szt2 UTSW 4 118,220,862 (GRCm39) unclassified probably benign
R2044:Szt2 UTSW 4 118,233,645 (GRCm39) nonsense probably null
R2066:Szt2 UTSW 4 118,231,177 (GRCm39) missense unknown
R2345:Szt2 UTSW 4 118,238,594 (GRCm39) missense unknown
R2857:Szt2 UTSW 4 118,226,599 (GRCm39) missense probably damaging 1.00
R3156:Szt2 UTSW 4 118,260,016 (GRCm39) critical splice donor site probably null
R3236:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3237:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3405:Szt2 UTSW 4 118,251,217 (GRCm39) missense probably benign 0.02
R3795:Szt2 UTSW 4 118,248,927 (GRCm39) missense probably damaging 1.00
R3878:Szt2 UTSW 4 118,247,782 (GRCm39) missense probably damaging 1.00
R3906:Szt2 UTSW 4 118,235,466 (GRCm39) unclassified probably benign
R4012:Szt2 UTSW 4 118,241,097 (GRCm39) missense probably benign 0.02
R4039:Szt2 UTSW 4 118,222,149 (GRCm39) unclassified probably benign
R4081:Szt2 UTSW 4 118,230,764 (GRCm39) splice site probably benign
R4298:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4299:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4432:Szt2 UTSW 4 118,241,428 (GRCm39) missense probably damaging 0.99
R4597:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R4657:Szt2 UTSW 4 118,254,866 (GRCm39) missense probably benign 0.06
R4663:Szt2 UTSW 4 118,234,881 (GRCm39) unclassified probably benign
R4670:Szt2 UTSW 4 118,233,026 (GRCm39) unclassified probably benign
R4704:Szt2 UTSW 4 118,251,026 (GRCm39) missense probably damaging 0.99
R4748:Szt2 UTSW 4 118,246,388 (GRCm39) nonsense probably null
R4786:Szt2 UTSW 4 118,256,259 (GRCm39) missense probably benign 0.20
R4809:Szt2 UTSW 4 118,246,182 (GRCm39) missense probably damaging 1.00
R4830:Szt2 UTSW 4 118,226,445 (GRCm39) missense unknown
R4944:Szt2 UTSW 4 118,245,866 (GRCm39) missense probably benign 0.03
R5077:Szt2 UTSW 4 118,226,813 (GRCm39) critical splice donor site probably null
R5121:Szt2 UTSW 4 118,242,641 (GRCm39) missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118,244,178 (GRCm39) missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118,247,027 (GRCm39) missense probably benign 0.26
R5198:Szt2 UTSW 4 118,245,519 (GRCm39) missense probably benign 0.03
R5433:Szt2 UTSW 4 118,232,663 (GRCm39) unclassified probably benign
R5625:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5628:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5630:Szt2 UTSW 4 118,250,102 (GRCm39) missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118,229,810 (GRCm39) missense unknown
R5902:Szt2 UTSW 4 118,248,700 (GRCm39) missense probably benign 0.05
R6049:Szt2 UTSW 4 118,260,185 (GRCm39) missense probably damaging 0.99
R6066:Szt2 UTSW 4 118,229,171 (GRCm39) missense unknown
R6272:Szt2 UTSW 4 118,231,487 (GRCm39) unclassified probably benign
R6456:Szt2 UTSW 4 118,233,894 (GRCm39) unclassified probably benign
R6538:Szt2 UTSW 4 118,247,674 (GRCm39) splice site probably null
R6604:Szt2 UTSW 4 118,242,671 (GRCm39) missense probably benign 0.01
R6664:Szt2 UTSW 4 118,248,942 (GRCm39) missense probably damaging 1.00
R6834:Szt2 UTSW 4 118,245,522 (GRCm39) missense probably benign 0.01
R7109:Szt2 UTSW 4 118,232,676 (GRCm39) missense unknown
R7163:Szt2 UTSW 4 118,262,727 (GRCm39) missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118,246,203 (GRCm39) missense probably damaging 0.98
R7289:Szt2 UTSW 4 118,233,075 (GRCm39) missense unknown
R7291:Szt2 UTSW 4 118,248,446 (GRCm39) missense probably damaging 0.98
R7383:Szt2 UTSW 4 118,222,411 (GRCm39) nonsense probably null
R7448:Szt2 UTSW 4 118,220,668 (GRCm39) missense unknown
R7637:Szt2 UTSW 4 118,251,025 (GRCm39) missense probably damaging 0.99
R7833:Szt2 UTSW 4 118,223,416 (GRCm39) missense unknown
R7896:Szt2 UTSW 4 118,260,110 (GRCm39) missense possibly damaging 0.62
R8090:Szt2 UTSW 4 118,244,199 (GRCm39) splice site probably null
R8103:Szt2 UTSW 4 118,245,061 (GRCm39) missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118,246,973 (GRCm39) missense probably damaging 0.96
R8309:Szt2 UTSW 4 118,232,679 (GRCm39) frame shift probably null
R8341:Szt2 UTSW 4 118,250,033 (GRCm39) missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118,244,015 (GRCm39) missense probably benign 0.01
R8497:Szt2 UTSW 4 118,245,518 (GRCm39) missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R8768:Szt2 UTSW 4 118,226,613 (GRCm39) missense unknown
R8992:Szt2 UTSW 4 118,239,985 (GRCm39) splice site probably benign
R9001:Szt2 UTSW 4 118,235,529 (GRCm39) missense unknown
R9094:Szt2 UTSW 4 118,242,651 (GRCm39) missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118,242,630 (GRCm39) missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118,221,866 (GRCm39) missense unknown
R9184:Szt2 UTSW 4 118,241,726 (GRCm39) missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118,242,288 (GRCm39) missense probably damaging 1.00
R9424:Szt2 UTSW 4 118,248,151 (GRCm39) missense probably damaging 1.00
R9598:Szt2 UTSW 4 118,266,358 (GRCm39) critical splice donor site probably null
X0023:Szt2 UTSW 4 118,229,601 (GRCm39) missense unknown
Z1176:Szt2 UTSW 4 118,251,173 (GRCm39) missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118,248,411 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTTAGCTTCCTGTAGTTGC -3'
(R):5'- GTCTTTAGACGCCGGACAAC -3'

Sequencing Primer
(F):5'- CCAGCTTTTAGGACTCTGGGAAG -3'
(R):5'- GGACCCTGCATCCCGTATTTG -3'
Posted On 2020-09-15