Incidental Mutation 'R0007:Olfr888'
ID64852
Institutional Source Beutler Lab
Gene Symbol Olfr888
Ensembl Gene ENSMUSG00000095527
Gene Nameolfactory receptor 888
SynonymsGA_x6K02T2PVTD-31787920-31788864, MOR162-4
MMRRC Submission 038302-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0007 (G1)
Quality Score113
Status Validated
Chromosome9
Chromosomal Location38108128-38111381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38109094 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 131 (Y131F)
Ref Sequence ENSEMBL: ENSMUSP00000148476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075228] [ENSMUST00000211851]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075228
AA Change: Y136F

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074713
Gene: ENSMUSG00000095527
AA Change: Y136F

DomainStartEndE-ValueType
Pfam:7tm_4 36 311 8.8e-49 PFAM
Pfam:7tm_1 46 293 3.9e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211851
AA Change: Y131F

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A T 17: 35,959,670 Y543N probably damaging Het
Adgrb3 C A 1: 25,111,691 probably null Het
AI504432 T A 3: 107,048,836 noncoding transcript Het
Cd82 T C 2: 93,433,881 N39S probably benign Het
Cntnap2 A C 6: 45,992,073 N250H possibly damaging Het
Col7a1 T C 9: 108,961,403 V973A unknown Het
Cyp2c66 T A 19: 39,170,958 C284* probably null Het
Denr T A 5: 123,924,814 Y127N probably damaging Het
Diaph3 C A 14: 86,866,620 R776L possibly damaging Het
Gm5600 T A 7: 113,707,773 noncoding transcript Het
Hephl1 A T 9: 15,086,175 D398E possibly damaging Het
Lama3 T A 18: 12,497,881 probably benign Het
Mtrr A T 13: 68,575,330 F154L probably benign Het
Myo1b T A 1: 51,776,254 R650S probably damaging Het
Nek10 T A 14: 14,840,574 H153Q probably benign Het
Nelfe A G 17: 34,853,986 probably benign Het
Nlrp9a T C 7: 26,551,090 probably benign Het
Nos1 T C 5: 117,910,088 S653P probably damaging Het
Olfr502 A G 7: 108,523,213 S246P probably damaging Het
Pcsk5 C A 19: 17,654,861 G314C probably damaging Het
Ralgps1 A G 2: 33,143,389 S393P probably damaging Het
Slc44a4 G A 17: 34,921,254 A60T probably damaging Het
Slc4a4 G A 5: 89,038,578 D173N probably damaging Het
Sparcl1 T A 5: 104,087,080 Q523L probably damaging Het
Srgap3 A G 6: 112,829,512 Y63H probably damaging Het
Trim16 A G 11: 62,829,118 M84V probably benign Het
Trpm3 G A 19: 22,987,529 A1453T probably benign Het
Ttn C T 2: 76,880,204 probably benign Het
Other mutations in Olfr888
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Olfr888 APN 9 38109562 missense probably damaging 1.00
IGL02158:Olfr888 APN 9 38109129 missense probably benign 0.09
IGL02713:Olfr888 APN 9 38109327 missense probably damaging 0.99
R0125:Olfr888 UTSW 9 38109519 missense probably benign 0.03
R0310:Olfr888 UTSW 9 38109486 missense possibly damaging 0.54
R1671:Olfr888 UTSW 9 38109132 missense probably benign
R3687:Olfr888 UTSW 9 38108881 missense probably damaging 1.00
R3704:Olfr888 UTSW 9 38109003 missense possibly damaging 0.95
R3708:Olfr888 UTSW 9 38109444 missense probably damaging 0.99
R3824:Olfr888 UTSW 9 38108838 missense possibly damaging 0.71
R3825:Olfr888 UTSW 9 38108838 missense possibly damaging 0.71
R4254:Olfr888 UTSW 9 38109250 missense probably damaging 1.00
R4828:Olfr888 UTSW 9 38108740 missense probably damaging 0.98
R7265:Olfr888 UTSW 9 38108931 missense possibly damaging 0.78
Z1088:Olfr888 UTSW 9 38109586 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGAAGAATGGCCTTCAGCAATG -3'
(R):5'- AGCTTCTGGAGAGGAGGTATGTCAC -3'

Sequencing Primer
(F):5'- ATCCTGCTGGGCTTAACACAG -3'
(R):5'- AGGTATGTCACACATGTAGTGATTG -3'
Posted On2013-08-06