Incidental Mutation 'R7923:Fras1'
ID648520
Institutional Source Beutler Lab
Gene Symbol Fras1
Ensembl Gene ENSMUSG00000034687
Gene NameFraser extracellular matrix complex subunit 1
Synonymsbl, E130113P14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7923 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location96373955-96784728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 96739318 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 2653 (A2653V)
Ref Sequence ENSEMBL: ENSMUSP00000043250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036019]
Predicted Effect probably damaging
Transcript: ENSMUST00000036019
AA Change: A2653V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043250
Gene: ENSMUSG00000034687
AA Change: A2653V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 27 86 9.23e-9 SMART
VWC 94 151 9.37e-10 SMART
VWC 158 215 8.61e-9 SMART
VWC 220 277 7.1e-10 SMART
VWC 284 341 7.8e-7 SMART
VWC 365 415 1.93e-1 SMART
FU 408 459 3.33e-1 SMART
FU 461 504 9.12e-8 SMART
EGF_like 466 495 6.67e1 SMART
FU 506 552 6.01e-8 SMART
FU 554 598 2.21e-6 SMART
FU 601 646 1.28e-11 SMART
FU 648 704 4.19e-7 SMART
FU 707 752 9.12e-8 SMART
FU 754 799 1.11e-6 SMART
EGF_like 759 790 7.23e1 SMART
FU 802 851 5.44e-6 SMART
EGF_like 807 842 4.55e1 SMART
FU 853 899 7.4e-8 SMART
FU 902 947 4.78e-2 SMART
FU 951 996 4.52e-12 SMART
EGF_like 956 987 2.75e1 SMART
FU 998 1041 1.38e-7 SMART
FU 1045 1088 9.7e-3 SMART
EGF_like 1057 1096 3.16e1 SMART
Pfam:Cadherin_3 1098 1198 5.2e-12 PFAM
Pfam:Cadherin_3 1167 1309 6.5e-27 PFAM
Pfam:Cadherin_3 1278 1442 7e-24 PFAM
Pfam:Cadherin_3 1411 1560 1.3e-23 PFAM
Pfam:Cadherin_3 1561 1693 6.4e-15 PFAM
Pfam:Cadherin_3 1695 1814 1.1e-10 PFAM
Pfam:Cadherin_3 1780 1940 1.6e-18 PFAM
Pfam:Cadherin_3 1906 2061 2.8e-22 PFAM
Pfam:Cadherin_3 2063 2181 3.3e-18 PFAM
Pfam:Cadherin_3 2172 2295 1.4e-26 PFAM
Pfam:Cadherin_3 2296 2408 2.3e-31 PFAM
Pfam:Cadherin_3 2413 2540 7.9e-23 PFAM
Calx_beta 2544 2648 1.23e-10 SMART
Calx_beta 2661 2772 3.3e-11 SMART
Calx_beta 2787 2892 1.21e-9 SMART
Calx_beta 2907 3009 4.45e-3 SMART
Calx_beta 3027 3131 1.5e-14 SMART
Blast:Calx_beta 3162 3187 1e-5 BLAST
transmembrane domain 3902 3924 N/A INTRINSIC
low complexity region 3927 3935 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein that appears to function in the regulation of epidermal-basement membrane adhesion and organogenesis during development. Mutations in this gene cause Fraser syndrome, a multisystem malformation that can include craniofacial, urogenital and respiratory system abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Survival is variable on genetic backgrounds. Kidney development is severely affected and syndactyly is common. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C T 8: 72,444,911 T54M probably damaging Het
4932443I19Rik A C 8: 13,738,456 H140P unknown Het
Aacs T A 5: 125,511,884 S409T probably damaging Het
Atf6 T C 1: 170,794,706 M449V probably benign Het
B4galt1 C T 4: 40,809,373 G332S probably benign Het
Bcl11a G T 11: 24,163,680 R341M probably damaging Het
Brf2 G A 8: 27,124,190 Q323* probably null Het
Bscl2 T C 19: 8,847,519 V322A probably benign Het
Btnl9 T C 11: 49,180,738 Y86C probably damaging Het
C4b T A 17: 34,742,380 I202F probably damaging Het
Cbfb T A 8: 105,194,593 probably null Het
Cc2d2b T A 19: 40,806,849 Y963N possibly damaging Het
Cep135 A T 5: 76,609,692 D391V possibly damaging Het
Col12a1 A G 9: 79,678,493 V1228A probably benign Het
Cr2 T A 1: 195,168,687 Y157F probably benign Het
Creg2 C T 1: 39,650,903 G13E probably benign Het
Cul5 G T 9: 53,624,166 A595E probably benign Het
Cyp4f16 A G 17: 32,546,747 E368G possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Eps15 G A 4: 109,315,872 D177N possibly damaging Het
Erbb4 C T 1: 68,259,209 R684H probably damaging Het
Ermp1 C T 19: 29,628,658 V419I probably benign Het
Foxi3 T C 6: 70,960,716 S311P probably benign Het
Gbp3 A T 3: 142,567,612 N307Y probably damaging Het
Ggcx G A 6: 72,427,917 R436Q probably damaging Het
Gimap3 A T 6: 48,765,627 V123D probably benign Het
Gm14326 A T 2: 177,945,887 Y439N probably damaging Het
Gm4756 G T 12: 72,619,358 Q180K probably benign Het
Gm5591 A G 7: 38,521,914 S244P probably benign Het
Gm9507 A T 10: 77,811,537 C103S unknown Het
Guf1 G A 5: 69,561,159 V214I probably benign Het
Ido2 T C 8: 24,576,193 Y19C probably damaging Het
Idua T C 5: 108,680,583 S268P probably damaging Het
Igf1r T C 7: 68,190,101 Y719H probably damaging Het
Itgb4 A T 11: 115,982,699 probably null Het
Kctd19 T A 8: 105,385,058 T868S probably damaging Het
Lonrf2 A T 1: 38,800,762 H417Q probably benign Het
Lrp2 T C 2: 69,438,388 T4184A possibly damaging Het
Mapk15 T C 15: 75,996,446 F219S probably damaging Het
Myh7b A T 2: 155,625,966 Y808F probably benign Het
Myo19 T G 11: 84,885,710 F64C possibly damaging Het
Mysm1 A T 4: 94,961,765 V434D probably damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nbeal2 A T 9: 110,631,446 Y1780* probably null Het
Ndc80 A T 17: 71,496,301 M615K probably benign Het
Nfkbib C A 7: 28,766,263 V54F probably damaging Het
Npy5r A G 8: 66,681,752 F130L probably damaging Het
Nt5c3 T C 6: 56,883,042 E304G probably benign Het
Odaph A G 5: 91,994,699 D40G possibly damaging Het
Olfr1389 C T 11: 49,430,605 T43I probably benign Het
Olfr1469 T C 19: 13,410,818 M83T probably benign Het
Olfr695 T A 7: 106,714,442 K80* probably null Het
Olfr974 A T 9: 39,942,967 K236* probably null Het
Palm3 T A 8: 84,029,461 I534K probably benign Het
Pde10a A G 17: 8,929,132 N89S probably benign Het
Piezo1 T C 8: 122,496,444 K870E Het
Pik3c2g T C 6: 139,633,793 probably null Het
Pnpla6 T A 8: 3,531,737 Y662* probably null Het
Proser3 A T 7: 30,549,661 F2Y possibly damaging Het
Psma5 A G 3: 108,265,129 I54V probably benign Het
Qrich2 C A 11: 116,457,337 G887V probably damaging Het
Rdx A G 9: 52,065,901 D150G possibly damaging Het
Reln C T 5: 22,134,692 V221I probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Samd14 A G 11: 95,023,458 probably null Het
Scimp A T 11: 70,791,515 I125N possibly damaging Het
Sec23a A G 12: 58,992,247 F289L probably damaging Het
Sipa1l3 G A 7: 29,339,146 Q1408* probably null Het
Skor2 T C 18: 76,858,721 L46P unknown Het
Slc12a1 A T 2: 125,214,092 I848F possibly damaging Het
Slc47a1 A G 11: 61,363,403 L211P probably damaging Het
Slc7a10 T C 7: 35,195,129 V71A probably damaging Het
Smco1 C A 16: 32,274,047 Q179K possibly damaging Het
Smg1 A G 7: 118,143,322 L3223P possibly damaging Het
Smpdl3a T C 10: 57,801,045 S80P probably damaging Het
Spire2 A G 8: 123,332,987 R75G probably benign Het
Sptbn2 T A 19: 4,746,799 H1808Q probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Ssfa2 G T 2: 79,662,615 E1169* probably null Het
Supv3l1 T C 10: 62,445,081 D177G probably damaging Het
Syne1 C T 10: 5,264,738 E3215K probably damaging Het
Szt2 A G 4: 118,373,840 V2548A unknown Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Washc2 A G 6: 116,226,424 E384G possibly damaging Het
Zfp712 T A 13: 67,042,185 N93Y probably benign Het
Other mutations in Fras1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Fras1 APN 5 96739358 missense possibly damaging 0.55
IGL00507:Fras1 APN 5 96778189 missense probably damaging 1.00
IGL00672:Fras1 APN 5 96759450 splice site probably benign
IGL00772:Fras1 APN 5 96636112 missense probably benign 0.42
IGL00844:Fras1 APN 5 96534853 splice site probably benign
IGL00913:Fras1 APN 5 96695076 missense probably damaging 0.99
IGL00959:Fras1 APN 5 96781281 missense probably damaging 0.96
IGL00966:Fras1 APN 5 96555221 missense probably benign 0.00
IGL01296:Fras1 APN 5 96673698 missense probably null 0.58
IGL01307:Fras1 APN 5 96781692 missense probably benign
IGL01481:Fras1 APN 5 96657241 missense probably damaging 1.00
IGL01525:Fras1 APN 5 96739336 missense probably damaging 0.99
IGL01599:Fras1 APN 5 96709891 missense possibly damaging 0.94
IGL01646:Fras1 APN 5 96758148 missense probably benign 0.29
IGL01795:Fras1 APN 5 96778045 missense probably damaging 1.00
IGL01867:Fras1 APN 5 96588131 missense probably benign
IGL01869:Fras1 APN 5 96708783 splice site probably benign
IGL01923:Fras1 APN 5 96735280 missense probably damaging 1.00
IGL01982:Fras1 APN 5 96739248 missense possibly damaging 0.46
IGL02109:Fras1 APN 5 96700523 missense probably benign
IGL02132:Fras1 APN 5 96781637 nonsense probably null
IGL02171:Fras1 APN 5 96735181 missense probably benign 0.15
IGL02213:Fras1 APN 5 96645871 nonsense probably null
IGL02277:Fras1 APN 5 96588118 missense probably benign 0.00
IGL02507:Fras1 APN 5 96657408 missense possibly damaging 0.95
IGL02589:Fras1 APN 5 96769513 missense probably damaging 1.00
IGL02671:Fras1 APN 5 96728616 missense possibly damaging 0.91
IGL02677:Fras1 APN 5 96545024 missense probably damaging 1.00
IGL02691:Fras1 APN 5 96744705 missense possibly damaging 0.68
IGL02741:Fras1 APN 5 96691371 missense probably benign 0.35
IGL02836:Fras1 APN 5 96534866 missense possibly damaging 0.67
IGL02850:Fras1 APN 5 96778175 missense probably damaging 1.00
IGL02998:Fras1 APN 5 96702181 missense possibly damaging 0.82
IGL03040:Fras1 APN 5 96710101 missense probably benign
IGL03078:Fras1 APN 5 96636135 missense probably damaging 1.00
IGL03096:Fras1 APN 5 96764901 missense probably damaging 1.00
IGL03102:Fras1 APN 5 96726535 missense probably benign 0.11
IGL03183:Fras1 APN 5 96733781 splice site probably benign
IGL03189:Fras1 APN 5 96743071 missense probably benign 0.00
IGL03193:Fras1 APN 5 96778106 missense probably damaging 0.99
IGL03292:Fras1 APN 5 96707491 missense probably damaging 1.00
IGL03328:Fras1 APN 5 96781760 missense probably damaging 0.96
IGL03335:Fras1 APN 5 96733944 splice site probably benign
IGL03394:Fras1 APN 5 96667477 missense probably damaging 0.98
IGL03404:Fras1 APN 5 96728581 missense probably damaging 0.99
baby_ruth UTSW 5 96708758 missense probably benign 0.01
BB002:Fras1 UTSW 5 96781584 missense probably damaging 0.96
BB012:Fras1 UTSW 5 96781584 missense probably damaging 0.96
G1patch:Fras1 UTSW 5 96781340 missense possibly damaging 0.91
I0000:Fras1 UTSW 5 96740829 missense probably damaging 0.99
PIT4581001:Fras1 UTSW 5 96555301 missense probably benign 0.01
R0028:Fras1 UTSW 5 96677316 missense probably benign 0.07
R0049:Fras1 UTSW 5 96776622 missense probably benign 0.07
R0049:Fras1 UTSW 5 96776622 missense probably benign 0.07
R0099:Fras1 UTSW 5 96614917 critical splice donor site probably null
R0109:Fras1 UTSW 5 96710077 missense probably benign 0.01
R0158:Fras1 UTSW 5 96776634 missense possibly damaging 0.83
R0268:Fras1 UTSW 5 96737009 missense probably damaging 0.99
R0305:Fras1 UTSW 5 96596888 missense probably benign
R0352:Fras1 UTSW 5 96726540 missense probably damaging 0.97
R0359:Fras1 UTSW 5 96762590 missense probably damaging 0.98
R0371:Fras1 UTSW 5 96555331 missense possibly damaging 0.90
R0379:Fras1 UTSW 5 96755509 nonsense probably null
R0395:Fras1 UTSW 5 96769653 missense possibly damaging 0.50
R0417:Fras1 UTSW 5 96691372 missense probably benign 0.18
R0454:Fras1 UTSW 5 96762665 missense probably damaging 0.96
R0456:Fras1 UTSW 5 96554788 missense probably damaging 1.00
R0456:Fras1 UTSW 5 96714343 splice site probably null
R0464:Fras1 UTSW 5 96636803 missense probably damaging 0.98
R0613:Fras1 UTSW 5 96700488 splice site probably benign
R0652:Fras1 UTSW 5 96781340 missense possibly damaging 0.91
R0675:Fras1 UTSW 5 96667387 splice site probably benign
R0765:Fras1 UTSW 5 96552796 missense probably benign 0.00
R0783:Fras1 UTSW 5 96768430 missense probably damaging 1.00
R0811:Fras1 UTSW 5 96752998 missense probably benign 0.35
R0812:Fras1 UTSW 5 96752998 missense probably benign 0.35
R0943:Fras1 UTSW 5 96726543 missense probably benign 0.00
R1037:Fras1 UTSW 5 96714463 missense probably damaging 0.97
R1104:Fras1 UTSW 5 96708671 missense probably benign 0.00
R1108:Fras1 UTSW 5 96642629 missense probably damaging 0.99
R1332:Fras1 UTSW 5 96707308 missense probably benign 0.00
R1336:Fras1 UTSW 5 96707308 missense probably benign 0.00
R1458:Fras1 UTSW 5 96600733 missense probably benign 0.00
R1495:Fras1 UTSW 5 96528586 missense possibly damaging 0.49
R1499:Fras1 UTSW 5 96743187 missense probably benign 0.31
R1528:Fras1 UTSW 5 96636819 missense probably damaging 0.99
R1532:Fras1 UTSW 5 96713996 missense probably damaging 1.00
R1556:Fras1 UTSW 5 96743062 missense possibly damaging 0.88
R1625:Fras1 UTSW 5 96709978 missense possibly damaging 0.94
R1625:Fras1 UTSW 5 96713990 missense probably damaging 1.00
R1645:Fras1 UTSW 5 96700586 missense possibly damaging 0.90
R1647:Fras1 UTSW 5 96726613 critical splice donor site probably null
R1648:Fras1 UTSW 5 96726613 critical splice donor site probably null
R1661:Fras1 UTSW 5 96598909 missense probably damaging 1.00
R1665:Fras1 UTSW 5 96598909 missense probably damaging 1.00
R1682:Fras1 UTSW 5 96645873 missense probably benign 0.00
R1701:Fras1 UTSW 5 96600784 missense probably benign 0.00
R1716:Fras1 UTSW 5 96552725 missense probably benign 0.10
R1718:Fras1 UTSW 5 96554889 splice site probably null
R1800:Fras1 UTSW 5 96709882 missense probably benign
R1806:Fras1 UTSW 5 96713970 splice site probably benign
R1806:Fras1 UTSW 5 96764976 missense possibly damaging 0.88
R1822:Fras1 UTSW 5 96770688 missense probably damaging 1.00
R1823:Fras1 UTSW 5 96770688 missense probably damaging 1.00
R1824:Fras1 UTSW 5 96770688 missense probably damaging 1.00
R1847:Fras1 UTSW 5 96749423 splice site probably null
R1929:Fras1 UTSW 5 96667437 missense probably benign 0.24
R1951:Fras1 UTSW 5 96712383 missense probably benign 0.38
R2093:Fras1 UTSW 5 96781203 missense probably damaging 1.00
R2283:Fras1 UTSW 5 96654305 missense probably benign 0.10
R2884:Fras1 UTSW 5 96700268 missense probably benign 0.07
R2913:Fras1 UTSW 5 96733915 missense probably benign
R2914:Fras1 UTSW 5 96733915 missense probably benign
R3054:Fras1 UTSW 5 96764943 missense probably damaging 0.99
R3117:Fras1 UTSW 5 96771712 missense probably damaging 1.00
R3118:Fras1 UTSW 5 96771712 missense probably damaging 1.00
R3691:Fras1 UTSW 5 96781512 missense probably benign 0.02
R3714:Fras1 UTSW 5 96645970 critical splice donor site probably null
R3715:Fras1 UTSW 5 96645970 critical splice donor site probably null
R3801:Fras1 UTSW 5 96733932 missense probably benign 0.26
R3961:Fras1 UTSW 5 96677385 critical splice donor site probably null
R4065:Fras1 UTSW 5 96770683 missense possibly damaging 0.64
R4066:Fras1 UTSW 5 96770683 missense possibly damaging 0.64
R4076:Fras1 UTSW 5 96743158 missense probably damaging 1.00
R4124:Fras1 UTSW 5 96770653 missense probably benign 0.05
R4127:Fras1 UTSW 5 96770653 missense probably benign 0.05
R4153:Fras1 UTSW 5 96776735 missense probably benign 0.17
R4233:Fras1 UTSW 5 96714376 missense possibly damaging 0.91
R4273:Fras1 UTSW 5 96614904 missense probably benign 0.00
R4355:Fras1 UTSW 5 96700242 missense probably benign
R4401:Fras1 UTSW 5 96642620 missense probably damaging 0.97
R4402:Fras1 UTSW 5 96642620 missense probably damaging 0.97
R4403:Fras1 UTSW 5 96642620 missense probably damaging 0.97
R4505:Fras1 UTSW 5 96781348 missense probably damaging 1.00
R4548:Fras1 UTSW 5 96709895 missense probably benign 0.00
R4559:Fras1 UTSW 5 96781289 missense probably damaging 1.00
R4629:Fras1 UTSW 5 96776734 missense probably benign 0.00
R4637:Fras1 UTSW 5 96778088 missense probably damaging 1.00
R4678:Fras1 UTSW 5 96700568 missense probably benign 0.13
R4707:Fras1 UTSW 5 96735238 missense probably damaging 0.96
R4735:Fras1 UTSW 5 96588163 missense probably benign 0.00
R4756:Fras1 UTSW 5 96781659 missense probably benign 0.00
R4762:Fras1 UTSW 5 96731618 missense probably benign
R4820:Fras1 UTSW 5 96728653 missense probably benign 0.00
R4847:Fras1 UTSW 5 96544992 missense possibly damaging 0.94
R4857:Fras1 UTSW 5 96778159 missense probably benign 0.00
R4909:Fras1 UTSW 5 96708758 missense probably benign 0.01
R4931:Fras1 UTSW 5 96636840 missense probably benign 0.02
R4938:Fras1 UTSW 5 96776724 missense probably damaging 0.99
R4952:Fras1 UTSW 5 96647498 missense probably benign 0.01
R4965:Fras1 UTSW 5 96726580 missense possibly damaging 0.95
R4989:Fras1 UTSW 5 96650682 missense possibly damaging 0.75
R5151:Fras1 UTSW 5 96645110 missense probably damaging 1.00
R5168:Fras1 UTSW 5 96708757 missense probably benign 0.00
R5182:Fras1 UTSW 5 96636173 nonsense probably null
R5214:Fras1 UTSW 5 96769593 missense probably damaging 1.00
R5220:Fras1 UTSW 5 96768363 missense probably damaging 1.00
R5235:Fras1 UTSW 5 96600750 missense probably benign 0.02
R5242:Fras1 UTSW 5 96657250 missense probably benign 0.11
R5253:Fras1 UTSW 5 96741025 missense probably damaging 0.99
R5260:Fras1 UTSW 5 96735187 missense possibly damaging 0.79
R5301:Fras1 UTSW 5 96657266 missense possibly damaging 0.88
R5411:Fras1 UTSW 5 96645160 missense probably benign 0.00
R5467:Fras1 UTSW 5 96780053 missense probably benign 0.04
R5543:Fras1 UTSW 5 96528535 missense probably benign 0.01
R5555:Fras1 UTSW 5 96677377 missense probably benign 0.34
R5602:Fras1 UTSW 5 96737021 missense probably damaging 1.00
R5664:Fras1 UTSW 5 96728535 missense possibly damaging 0.91
R5695:Fras1 UTSW 5 96781344 missense probably damaging 1.00
R5717:Fras1 UTSW 5 96781737 missense possibly damaging 0.93
R5742:Fras1 UTSW 5 96768381 missense possibly damaging 0.50
R5759:Fras1 UTSW 5 96709916 missense probably benign 0.02
R5766:Fras1 UTSW 5 96731689 missense possibly damaging 0.91
R5890:Fras1 UTSW 5 96645948 missense probably benign
R6052:Fras1 UTSW 5 96764866 missense probably damaging 1.00
R6058:Fras1 UTSW 5 96709985 missense probably benign
R6256:Fras1 UTSW 5 96733843 missense possibly damaging 0.84
R6306:Fras1 UTSW 5 96764946 missense probably damaging 1.00
R6494:Fras1 UTSW 5 96759564 missense possibly damaging 0.59
R6638:Fras1 UTSW 5 96758094 missense possibly damaging 0.94
R6647:Fras1 UTSW 5 96735202 missense probably damaging 1.00
R6725:Fras1 UTSW 5 96781340 missense possibly damaging 0.91
R6769:Fras1 UTSW 5 96598941 missense possibly damaging 0.60
R6771:Fras1 UTSW 5 96598941 missense possibly damaging 0.60
R6837:Fras1 UTSW 5 96726973 missense probably damaging 0.99
R6841:Fras1 UTSW 5 96728551 missense probably damaging 0.99
R6863:Fras1 UTSW 5 96543306 missense probably benign 0.19
R6868:Fras1 UTSW 5 96682378 missense probably benign 0.38
R6936:Fras1 UTSW 5 96768352 missense possibly damaging 0.92
R6997:Fras1 UTSW 5 96614873 nonsense probably null
R7023:Fras1 UTSW 5 96710084 missense probably benign 0.00
R7091:Fras1 UTSW 5 96708676 missense probably benign
R7102:Fras1 UTSW 5 96571041 missense probably benign
R7120:Fras1 UTSW 5 96752960 nonsense probably null
R7124:Fras1 UTSW 5 96714401 missense probably damaging 1.00
R7129:Fras1 UTSW 5 96781284 missense probably benign 0.00
R7173:Fras1 UTSW 5 96778078 missense probably damaging 1.00
R7174:Fras1 UTSW 5 96755577 critical splice donor site probably null
R7185:Fras1 UTSW 5 96636776 missense probably damaging 1.00
R7191:Fras1 UTSW 5 96614912 missense probably benign 0.05
R7216:Fras1 UTSW 5 96739314 missense probably damaging 1.00
R7222:Fras1 UTSW 5 96636186 missense probably damaging 1.00
R7222:Fras1 UTSW 5 96636809 missense probably benign 0.00
R7320:Fras1 UTSW 5 96709886 missense probably benign 0.03
R7335:Fras1 UTSW 5 96736970 missense possibly damaging 0.82
R7378:Fras1 UTSW 5 96596785 missense probably damaging 0.98
R7394:Fras1 UTSW 5 96712450 nonsense probably null
R7412:Fras1 UTSW 5 96614889 missense probably benign 0.06
R7422:Fras1 UTSW 5 96673599 missense probably benign 0.21
R7552:Fras1 UTSW 5 96768438 missense probably damaging 1.00
R7559:Fras1 UTSW 5 96740854 missense possibly damaging 0.82
R7575:Fras1 UTSW 5 96543314 missense probably benign 0.02
R7578:Fras1 UTSW 5 96684437 missense probably damaging 1.00
R7600:Fras1 UTSW 5 96684436 missense probably damaging 1.00
R7669:Fras1 UTSW 5 96692624 missense probably benign 0.01
R7710:Fras1 UTSW 5 96645103 nonsense probably null
R7722:Fras1 UTSW 5 96769554 missense probably damaging 1.00
R7726:Fras1 UTSW 5 96712451 missense probably benign 0.41
R7745:Fras1 UTSW 5 96726895 missense probably benign 0.11
R7777:Fras1 UTSW 5 96752904 missense probably damaging 1.00
R7925:Fras1 UTSW 5 96781584 missense probably damaging 0.96
R8000:Fras1 UTSW 5 96762677 missense probably damaging 0.96
R8056:Fras1 UTSW 5 96744774 missense probably damaging 1.00
R8058:Fras1 UTSW 5 96694919 missense probably benign
R8117:Fras1 UTSW 5 96707386 missense probably damaging 1.00
R8157:Fras1 UTSW 5 96554855 missense probably benign 0.00
R8312:Fras1 UTSW 5 96588191 missense probably benign
R8315:Fras1 UTSW 5 96743182 missense probably damaging 0.97
R8412:Fras1 UTSW 5 96596852 missense probably benign 0.00
R8546:Fras1 UTSW 5 96709966 missense probably benign 0.00
R8705:Fras1 UTSW 5 96691401 missense probably benign 0.01
R8790:Fras1 UTSW 5 96755377 missense probably damaging 1.00
R8848:Fras1 UTSW 5 96781348 missense probably damaging 1.00
R8855:Fras1 UTSW 5 96769606 missense
R8871:Fras1 UTSW 5 96707398 missense probably benign 0.34
R8894:Fras1 UTSW 5 96759543 missense probably damaging 1.00
R8904:Fras1 UTSW 5 96781279 missense probably benign 0.16
R8910:Fras1 UTSW 5 96567996 missense probably benign 0.01
R8916:Fras1 UTSW 5 96752915 missense probably damaging 1.00
R8929:Fras1 UTSW 5 96769507 missense probably damaging 0.98
Z1088:Fras1 UTSW 5 96743211 missense probably damaging 0.97
Z1088:Fras1 UTSW 5 96758142 missense probably benign
Z1176:Fras1 UTSW 5 96758142 missense probably benign
Z1177:Fras1 UTSW 5 96691457 missense probably damaging 1.00
Z1177:Fras1 UTSW 5 96700251 missense possibly damaging 0.71
Z1177:Fras1 UTSW 5 96740811 missense probably benign 0.18
Z1177:Fras1 UTSW 5 96740983 missense possibly damaging 0.95
Z1177:Fras1 UTSW 5 96758142 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCATAATCTCCGGACTGACCAG -3'
(R):5'- TGAGTACTCAGCACACAGAAG -3'

Sequencing Primer
(F):5'- GGGGATGCTAAGGTGATGCCC -3'
(R):5'- GGCTCAATGGATATTAGTGATCACC -3'
Posted On2020-09-15