Incidental Mutation 'R7923:Pnpla6'
ID648540
Institutional Source Beutler Lab
Gene Symbol Pnpla6
Ensembl Gene ENSMUSG00000004565
Gene Namepatatin-like phospholipase domain containing 6
SynonymsNte, Swiss-cheese, MSws
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7923 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location3515384-3544267 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 3531737 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 662 (Y662*)
Ref Sequence ENSEMBL: ENSMUSP00000146680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004681] [ENSMUST00000111070] [ENSMUST00000207421] [ENSMUST00000207941] [ENSMUST00000208002]
Predicted Effect probably null
Transcript: ENSMUST00000004681
AA Change: Y644*
SMART Domains Protein: ENSMUSP00000004681
Gene: ENSMUSG00000004565
AA Change: Y644*

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 5e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111070
AA Change: Y644*
SMART Domains Protein: ENSMUSP00000106699
Gene: ENSMUSG00000004565
AA Change: Y644*

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207421
Predicted Effect probably null
Transcript: ENSMUST00000207941
AA Change: Y672*
Predicted Effect probably null
Transcript: ENSMUST00000208002
AA Change: Y662*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase that deacetylates intracellular phosphatidylcholine to produce glycerophosphocholine. It is thought to function in neurite outgrowth and process elongation during neuronal differentiation. The protein is anchored to the cytoplasmic face of the endoplasmic reticulum in both neurons and non-neuronal cells. Mutations in this gene result in autosomal recessive spastic paraplegia, and the protein is the target for neurodegeneration induced by organophosphorus compounds and chemical warfare agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during early gestation. Conditional inactivation in the central nervous system leads to neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C T 8: 72,444,911 T54M probably damaging Het
4932443I19Rik A C 8: 13,738,456 H140P unknown Het
Aacs T A 5: 125,511,884 S409T probably damaging Het
Atf6 T C 1: 170,794,706 M449V probably benign Het
B4galt1 C T 4: 40,809,373 G332S probably benign Het
Bcl11a G T 11: 24,163,680 R341M probably damaging Het
Brf2 G A 8: 27,124,190 Q323* probably null Het
Bscl2 T C 19: 8,847,519 V322A probably benign Het
Btnl9 T C 11: 49,180,738 Y86C probably damaging Het
C4b T A 17: 34,742,380 I202F probably damaging Het
Cbfb T A 8: 105,194,593 probably null Het
Cc2d2b T A 19: 40,806,849 Y963N possibly damaging Het
Cep135 A T 5: 76,609,692 D391V possibly damaging Het
Col12a1 A G 9: 79,678,493 V1228A probably benign Het
Cr2 T A 1: 195,168,687 Y157F probably benign Het
Creg2 C T 1: 39,650,903 G13E probably benign Het
Cul5 G T 9: 53,624,166 A595E probably benign Het
Cyp4f16 A G 17: 32,546,747 E368G possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Eps15 G A 4: 109,315,872 D177N possibly damaging Het
Erbb4 C T 1: 68,259,209 R684H probably damaging Het
Ermp1 C T 19: 29,628,658 V419I probably benign Het
Foxi3 T C 6: 70,960,716 S311P probably benign Het
Fras1 C T 5: 96,739,318 A2653V probably damaging Het
Gbp3 A T 3: 142,567,612 N307Y probably damaging Het
Ggcx G A 6: 72,427,917 R436Q probably damaging Het
Gimap3 A T 6: 48,765,627 V123D probably benign Het
Gm14326 A T 2: 177,945,887 Y439N probably damaging Het
Gm4756 G T 12: 72,619,358 Q180K probably benign Het
Gm5591 A G 7: 38,521,914 S244P probably benign Het
Gm9507 A T 10: 77,811,537 C103S unknown Het
Guf1 G A 5: 69,561,159 V214I probably benign Het
Ido2 T C 8: 24,576,193 Y19C probably damaging Het
Idua T C 5: 108,680,583 S268P probably damaging Het
Igf1r T C 7: 68,190,101 Y719H probably damaging Het
Itgb4 A T 11: 115,982,699 probably null Het
Kctd19 T A 8: 105,385,058 T868S probably damaging Het
Lonrf2 A T 1: 38,800,762 H417Q probably benign Het
Lrp2 T C 2: 69,438,388 T4184A possibly damaging Het
Mapk15 T C 15: 75,996,446 F219S probably damaging Het
Myh7b A T 2: 155,625,966 Y808F probably benign Het
Myo19 T G 11: 84,885,710 F64C possibly damaging Het
Mysm1 A T 4: 94,961,765 V434D probably damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nbeal2 A T 9: 110,631,446 Y1780* probably null Het
Ndc80 A T 17: 71,496,301 M615K probably benign Het
Nfkbib C A 7: 28,766,263 V54F probably damaging Het
Npy5r A G 8: 66,681,752 F130L probably damaging Het
Nt5c3 T C 6: 56,883,042 E304G probably benign Het
Odaph A G 5: 91,994,699 D40G possibly damaging Het
Olfr1389 C T 11: 49,430,605 T43I probably benign Het
Olfr1469 T C 19: 13,410,818 M83T probably benign Het
Olfr695 T A 7: 106,714,442 K80* probably null Het
Olfr974 A T 9: 39,942,967 K236* probably null Het
Palm3 T A 8: 84,029,461 I534K probably benign Het
Pde10a A G 17: 8,929,132 N89S probably benign Het
Piezo1 T C 8: 122,496,444 K870E Het
Pik3c2g T C 6: 139,633,793 probably null Het
Proser3 A T 7: 30,549,661 F2Y possibly damaging Het
Psma5 A G 3: 108,265,129 I54V probably benign Het
Qrich2 C A 11: 116,457,337 G887V probably damaging Het
Rdx A G 9: 52,065,901 D150G possibly damaging Het
Reln C T 5: 22,134,692 V221I probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Samd14 A G 11: 95,023,458 probably null Het
Scimp A T 11: 70,791,515 I125N possibly damaging Het
Sec23a A G 12: 58,992,247 F289L probably damaging Het
Sipa1l3 G A 7: 29,339,146 Q1408* probably null Het
Skor2 T C 18: 76,858,721 L46P unknown Het
Slc12a1 A T 2: 125,214,092 I848F possibly damaging Het
Slc47a1 A G 11: 61,363,403 L211P probably damaging Het
Slc7a10 T C 7: 35,195,129 V71A probably damaging Het
Smco1 C A 16: 32,274,047 Q179K possibly damaging Het
Smg1 A G 7: 118,143,322 L3223P possibly damaging Het
Smpdl3a T C 10: 57,801,045 S80P probably damaging Het
Spire2 A G 8: 123,332,987 R75G probably benign Het
Sptbn2 T A 19: 4,746,799 H1808Q probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Ssfa2 G T 2: 79,662,615 E1169* probably null Het
Supv3l1 T C 10: 62,445,081 D177G probably damaging Het
Syne1 C T 10: 5,264,738 E3215K probably damaging Het
Szt2 A G 4: 118,373,840 V2548A unknown Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Washc2 A G 6: 116,226,424 E384G possibly damaging Het
Zfp712 T A 13: 67,042,185 N93Y probably benign Het
Other mutations in Pnpla6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pnpla6 APN 8 3523808 missense probably damaging 1.00
IGL00820:Pnpla6 APN 8 3532358 missense possibly damaging 0.95
IGL00839:Pnpla6 APN 8 3542299 missense probably benign 0.05
IGL01732:Pnpla6 APN 8 3522616 missense probably damaging 0.99
IGL01973:Pnpla6 APN 8 3517619 missense probably damaging 1.00
IGL02267:Pnpla6 APN 8 3517327 missense probably benign 0.00
IGL03246:Pnpla6 APN 8 3531530 missense probably benign 0.01
IGL03286:Pnpla6 APN 8 3531473 missense probably damaging 0.99
Immemorial UTSW 8 3531677 missense probably benign 0.38
Mammilary UTSW 8 3521384 missense probably benign 0.01
I0000:Pnpla6 UTSW 8 3542322 missense probably benign
R0141:Pnpla6 UTSW 8 3532117 critical splice donor site probably null
R0180:Pnpla6 UTSW 8 3524250 critical splice acceptor site probably null
R0377:Pnpla6 UTSW 8 3541501 missense probably damaging 1.00
R0563:Pnpla6 UTSW 8 3523333 missense possibly damaging 0.51
R0660:Pnpla6 UTSW 8 3522269 unclassified probably benign
R0786:Pnpla6 UTSW 8 3523317 missense probably benign
R0827:Pnpla6 UTSW 8 3517618 missense possibly damaging 0.71
R0882:Pnpla6 UTSW 8 3517081 missense probably damaging 1.00
R1512:Pnpla6 UTSW 8 3535459 splice site probably benign
R1552:Pnpla6 UTSW 8 3522403 missense probably damaging 1.00
R1609:Pnpla6 UTSW 8 3517135 missense probably damaging 1.00
R1770:Pnpla6 UTSW 8 3534634 missense possibly damaging 0.94
R1779:Pnpla6 UTSW 8 3541404 missense probably damaging 1.00
R1987:Pnpla6 UTSW 8 3542370 missense probably benign 0.00
R3079:Pnpla6 UTSW 8 3541512 missense probably benign 0.25
R3125:Pnpla6 UTSW 8 3534670 missense probably null 1.00
R4171:Pnpla6 UTSW 8 3543997 missense probably benign 0.09
R4281:Pnpla6 UTSW 8 3521513 missense probably damaging 1.00
R4674:Pnpla6 UTSW 8 3521412 missense probably damaging 1.00
R4776:Pnpla6 UTSW 8 3523818 missense probably benign 0.01
R4779:Pnpla6 UTSW 8 3522838 missense probably benign 0.00
R5114:Pnpla6 UTSW 8 3522613 missense probably damaging 0.98
R5459:Pnpla6 UTSW 8 3535829 missense probably benign 0.01
R5510:Pnpla6 UTSW 8 3521397 missense probably damaging 0.99
R5538:Pnpla6 UTSW 8 3531508 missense probably benign 0.01
R5664:Pnpla6 UTSW 8 3537478 missense probably damaging 0.98
R6063:Pnpla6 UTSW 8 3524156 missense probably benign 0.21
R6314:Pnpla6 UTSW 8 3521572 missense probably benign 0.39
R6321:Pnpla6 UTSW 8 3544015 missense probably benign
R6454:Pnpla6 UTSW 8 3537986 missense probably damaging 0.99
R6477:Pnpla6 UTSW 8 3536627 missense probably benign 0.00
R6524:Pnpla6 UTSW 8 3534519 splice site probably null
R6809:Pnpla6 UTSW 8 3534611 missense possibly damaging 0.72
R6975:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7293:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7389:Pnpla6 UTSW 8 3543981 nonsense probably null
R7426:Pnpla6 UTSW 8 3516540 splice site probably null
R7520:Pnpla6 UTSW 8 3537508 missense probably damaging 1.00
R7666:Pnpla6 UTSW 8 3541591 missense probably benign 0.01
R7733:Pnpla6 UTSW 8 3522660 missense probably benign 0.01
R7743:Pnpla6 UTSW 8 3536594 missense possibly damaging 0.77
R7744:Pnpla6 UTSW 8 3531677 missense probably benign 0.38
R7980:Pnpla6 UTSW 8 3536562 missense probably damaging 0.97
R8141:Pnpla6 UTSW 8 3521384 missense probably benign 0.01
R8191:Pnpla6 UTSW 8 3542382 missense probably benign 0.12
R8251:Pnpla6 UTSW 8 3532399 missense probably benign 0.29
R8881:Pnpla6 UTSW 8 3531489 missense probably benign 0.00
R8917:Pnpla6 UTSW 8 3517637 missense possibly damaging 0.50
R8939:Pnpla6 UTSW 8 3521319 missense possibly damaging 0.86
X0018:Pnpla6 UTSW 8 3517337 missense probably damaging 1.00
Z1177:Pnpla6 UTSW 8 3536979 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AGATGGACTTTGCCATTGACTG -3'
(R):5'- TTCTGACTCACAGGAAGGAGCC -3'

Sequencing Primer
(F):5'- CATTGACTGGACAGCTGTGGAG -3'
(R):5'- CCAGGGAAGAGGTCTGGGTTG -3'
Posted On2020-09-15