Incidental Mutation 'R7923:Rdx'
ID 648554
Institutional Source Beutler Lab
Gene Symbol Rdx
Ensembl Gene ENSMUSG00000032050
Gene Name radixin
Synonyms
MMRRC Submission 045970-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7923 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 51958450-52000038 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 51977201 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 150 (D150G)
Ref Sequence ENSEMBL: ENSMUSP00000000590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000590] [ENSMUST00000061352] [ENSMUST00000163153]
AlphaFold P26043
Predicted Effect possibly damaging
Transcript: ENSMUST00000000590
AA Change: D150G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000590
Gene: ENSMUSG00000032050
AA Change: D150G

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 6e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000061352
AA Change: D150G

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055303
Gene: ENSMUSG00000032050
AA Change: D150G

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
coiled coil region 300 365 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163153
AA Change: D150G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128249
Gene: ENSMUSG00000032050
AA Change: D150G

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 3.4e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted mutation display mild degenerative changes in the liver and hyperbilirubinemia. Adult homozygotes exhibit profound deafness, but not imbalance, associated with progressive degeneration of stereocilia of cochlear hair cells after the onset of hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C T 8: 73,198,755 (GRCm39) T54M probably damaging Het
Aacs T A 5: 125,588,948 (GRCm39) S409T probably damaging Het
Atf6 T C 1: 170,622,275 (GRCm39) M449V probably benign Het
B4galt1 C T 4: 40,809,373 (GRCm39) G332S probably benign Het
Bcl11a G T 11: 24,113,680 (GRCm39) R341M probably damaging Het
Brf2 G A 8: 27,614,218 (GRCm39) Q323* probably null Het
Bscl2 T C 19: 8,824,883 (GRCm39) V322A probably benign Het
Btnl9 T C 11: 49,071,565 (GRCm39) Y86C probably damaging Het
C4b T A 17: 34,961,354 (GRCm39) I202F probably damaging Het
Cbfb T A 8: 105,921,225 (GRCm39) probably null Het
Cc2d2b T A 19: 40,795,293 (GRCm39) Y963N possibly damaging Het
Cep135 A T 5: 76,757,539 (GRCm39) D391V possibly damaging Het
Cfap97d2 A C 8: 13,788,456 (GRCm39) H140P unknown Het
Col12a1 A G 9: 79,585,775 (GRCm39) V1228A probably benign Het
Cr2 T A 1: 194,850,995 (GRCm39) Y157F probably benign Het
Creg2 C T 1: 39,690,071 (GRCm39) G13E probably benign Het
Cul5 G T 9: 53,535,466 (GRCm39) A595E probably benign Het
Cyp4f16 A G 17: 32,765,721 (GRCm39) E368G possibly damaging Het
Dhrs7l G T 12: 72,666,132 (GRCm39) Q180K probably benign Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,739,935 (GRCm39) probably benign Het
Eps15 G A 4: 109,173,069 (GRCm39) D177N possibly damaging Het
Erbb4 C T 1: 68,298,368 (GRCm39) R684H probably damaging Het
Ermp1 C T 19: 29,606,058 (GRCm39) V419I probably benign Het
Foxi3 T C 6: 70,937,700 (GRCm39) S311P probably benign Het
Fras1 C T 5: 96,887,177 (GRCm39) A2653V probably damaging Het
Gbp3 A T 3: 142,273,373 (GRCm39) N307Y probably damaging Het
Ggcx G A 6: 72,404,900 (GRCm39) R436Q probably damaging Het
Gimap3 A T 6: 48,742,561 (GRCm39) V123D probably benign Het
Gm14326 A T 2: 177,587,680 (GRCm39) Y439N probably damaging Het
Gm5591 A G 7: 38,221,338 (GRCm39) S244P probably benign Het
Gm9507 A T 10: 77,647,371 (GRCm39) C103S unknown Het
Guf1 G A 5: 69,718,502 (GRCm39) V214I probably benign Het
Ido2 T C 8: 25,066,209 (GRCm39) Y19C probably damaging Het
Idua T C 5: 108,828,449 (GRCm39) S268P probably damaging Het
Igf1r T C 7: 67,839,849 (GRCm39) Y719H probably damaging Het
Itgb4 A T 11: 115,873,525 (GRCm39) probably null Het
Itprid2 G T 2: 79,492,959 (GRCm39) E1169* probably null Het
Kctd19 T A 8: 106,111,690 (GRCm39) T868S probably damaging Het
Lonrf2 A T 1: 38,839,843 (GRCm39) H417Q probably benign Het
Lrp2 T C 2: 69,268,732 (GRCm39) T4184A possibly damaging Het
Mapk15 T C 15: 75,868,295 (GRCm39) F219S probably damaging Het
Myh7b A T 2: 155,467,886 (GRCm39) Y808F probably benign Het
Myo19 T G 11: 84,776,536 (GRCm39) F64C possibly damaging Het
Mysm1 A T 4: 94,850,002 (GRCm39) V434D probably damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 67,313,200 (GRCm39) probably benign Het
Nbeal2 A T 9: 110,460,514 (GRCm39) Y1780* probably null Het
Ndc80 A T 17: 71,803,296 (GRCm39) M615K probably benign Het
Nfkbib C A 7: 28,465,688 (GRCm39) V54F probably damaging Het
Npy5r A G 8: 67,134,404 (GRCm39) F130L probably damaging Het
Nt5c3 T C 6: 56,860,027 (GRCm39) E304G probably benign Het
Odaph A G 5: 92,142,558 (GRCm39) D40G possibly damaging Het
Or2ag13 T A 7: 106,313,649 (GRCm39) K80* probably null Het
Or2y1d C T 11: 49,321,432 (GRCm39) T43I probably benign Het
Or5b3 T C 19: 13,388,182 (GRCm39) M83T probably benign Het
Or8d6 A T 9: 39,854,263 (GRCm39) K236* probably null Het
Palm3 T A 8: 84,756,090 (GRCm39) I534K probably benign Het
Pde10a A G 17: 9,147,964 (GRCm39) N89S probably benign Het
Piezo1 T C 8: 123,223,183 (GRCm39) K870E Het
Pik3c2g T C 6: 139,610,791 (GRCm39) probably null Het
Pnpla6 T A 8: 3,581,737 (GRCm39) Y662* probably null Het
Proser3 A T 7: 30,249,086 (GRCm39) F2Y possibly damaging Het
Psma5 A G 3: 108,172,445 (GRCm39) I54V probably benign Het
Qrich2 C A 11: 116,348,163 (GRCm39) G887V probably damaging Het
Reln C T 5: 22,339,690 (GRCm39) V221I probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Samd14 A G 11: 94,914,284 (GRCm39) probably null Het
Scimp A T 11: 70,682,341 (GRCm39) I125N possibly damaging Het
Sec23a A G 12: 59,039,033 (GRCm39) F289L probably damaging Het
Sipa1l3 G A 7: 29,038,571 (GRCm39) Q1408* probably null Het
Skor2 T C 18: 76,946,416 (GRCm39) L46P unknown Het
Slc12a1 A T 2: 125,056,012 (GRCm39) I848F possibly damaging Het
Slc47a1 A G 11: 61,254,229 (GRCm39) L211P probably damaging Het
Slc7a10 T C 7: 34,894,554 (GRCm39) V71A probably damaging Het
Smco1 C A 16: 32,092,865 (GRCm39) Q179K possibly damaging Het
Smg1 A G 7: 117,742,545 (GRCm39) L3223P possibly damaging Het
Smpdl3a T C 10: 57,677,141 (GRCm39) S80P probably damaging Het
Spire2 A G 8: 124,059,726 (GRCm39) R75G probably benign Het
Sptbn2 T A 19: 4,796,827 (GRCm39) H1808Q probably benign Het
Srgap2 T C 1: 131,228,151 (GRCm39) E720G possibly damaging Het
Supv3l1 T C 10: 62,280,860 (GRCm39) D177G probably damaging Het
Syne1 C T 10: 5,214,738 (GRCm39) E3215K probably damaging Het
Szt2 A G 4: 118,231,037 (GRCm39) V2548A unknown Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Washc2 A G 6: 116,203,385 (GRCm39) E384G possibly damaging Het
Zfp712 T A 13: 67,190,249 (GRCm39) N93Y probably benign Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Other mutations in Rdx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Rdx APN 9 51,997,646 (GRCm39) missense probably damaging 1.00
IGL02088:Rdx APN 9 51,972,183 (GRCm39) utr 5 prime probably benign
IGL02522:Rdx APN 9 51,979,504 (GRCm39) missense possibly damaging 0.92
R0731:Rdx UTSW 9 51,979,518 (GRCm39) missense probably benign 0.05
R0748:Rdx UTSW 9 51,976,160 (GRCm39) missense possibly damaging 0.87
R0831:Rdx UTSW 9 51,977,117 (GRCm39) missense probably damaging 1.00
R1605:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R1688:Rdx UTSW 9 51,972,211 (GRCm39) splice site probably benign
R2127:Rdx UTSW 9 51,981,032 (GRCm39) missense possibly damaging 0.49
R2363:Rdx UTSW 9 51,980,173 (GRCm39) missense probably damaging 1.00
R2899:Rdx UTSW 9 51,980,211 (GRCm39) splice site probably benign
R4184:Rdx UTSW 9 51,978,680 (GRCm39) missense probably damaging 1.00
R4569:Rdx UTSW 9 51,980,141 (GRCm39) missense probably benign 0.07
R4607:Rdx UTSW 9 51,980,137 (GRCm39) missense probably damaging 0.99
R4760:Rdx UTSW 9 51,977,174 (GRCm39) missense probably benign 0.02
R4820:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R4966:Rdx UTSW 9 51,986,309 (GRCm39) missense probably benign 0.00
R6707:Rdx UTSW 9 51,974,954 (GRCm39) missense probably damaging 1.00
R7136:Rdx UTSW 9 51,997,745 (GRCm39) missense probably damaging 1.00
R7308:Rdx UTSW 9 51,980,170 (GRCm39) missense probably damaging 0.98
R7597:Rdx UTSW 9 51,972,196 (GRCm39) missense possibly damaging 0.84
R7835:Rdx UTSW 9 51,977,088 (GRCm39) missense probably damaging 0.98
R8055:Rdx UTSW 9 51,997,724 (GRCm39) missense probably damaging 1.00
R8057:Rdx UTSW 9 51,976,946 (GRCm39) missense probably damaging 1.00
R8889:Rdx UTSW 9 51,997,753 (GRCm39) missense probably damaging 1.00
R8983:Rdx UTSW 9 51,974,905 (GRCm39) missense probably damaging 1.00
R9128:Rdx UTSW 9 51,976,179 (GRCm39) nonsense probably null
R9226:Rdx UTSW 9 51,992,468 (GRCm39) missense probably benign 0.01
R9377:Rdx UTSW 9 51,980,168 (GRCm39) missense possibly damaging 0.83
R9469:Rdx UTSW 9 51,977,069 (GRCm39) missense probably damaging 1.00
R9534:Rdx UTSW 9 51,984,482 (GRCm39) nonsense probably null
R9746:Rdx UTSW 9 51,974,878 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTGAAGATGTTTCTGAGGAATTG -3'
(R):5'- TTCATAGCCTTCCCTAAAGAGCAAATC -3'

Sequencing Primer
(F):5'- AGATGTTTCTGAGGAATTGATTCAAG -3'
(R):5'- TGCACATCCTATAGGCATTGAAC -3'
Posted On 2020-09-15