Incidental Mutation 'R7923:Zfp712'
ID648573
Institutional Source Beutler Lab
Gene Symbol Zfp712
Ensembl Gene ENSMUSG00000090641
Gene Namezinc finger protein 712
Synonyms4921504N20Rik, mszf31, mszf89
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7923 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67038596-67061170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67042185 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 93 (N93Y)
Ref Sequence ENSEMBL: ENSMUSP00000126665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167565]
Predicted Effect probably benign
Transcript: ENSMUST00000167565
AA Change: N93Y

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000126665
Gene: ENSMUSG00000090641
AA Change: N93Y

DomainStartEndE-ValueType
KRAB 5 65 7.38e-36 SMART
ZnF_C2H2 109 131 1.28e-3 SMART
ZnF_C2H2 137 159 4.17e-3 SMART
ZnF_C2H2 165 186 1.73e0 SMART
ZnF_C2H2 192 214 3.39e-3 SMART
ZnF_C2H2 220 242 1.58e-3 SMART
ZnF_C2H2 248 270 8.34e-3 SMART
ZnF_C2H2 276 298 4.17e-3 SMART
ZnF_C2H2 304 326 4.87e-4 SMART
ZnF_C2H2 332 354 1.04e-3 SMART
ZnF_C2H2 360 382 5.5e-3 SMART
ZnF_C2H2 388 410 1.89e-1 SMART
ZnF_C2H2 416 438 7.15e-2 SMART
ZnF_C2H2 444 466 3.58e-2 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 2.12e-4 SMART
ZnF_C2H2 528 550 3.83e-2 SMART
ZnF_C2H2 556 578 2.95e-3 SMART
ZnF_C2H2 584 606 6.32e-3 SMART
ZnF_C2H2 612 634 3.89e-3 SMART
ZnF_C2H2 640 662 3.49e-5 SMART
ZnF_C2H2 668 690 1.84e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C T 8: 72,444,911 T54M probably damaging Het
4932443I19Rik A C 8: 13,738,456 H140P unknown Het
Aacs T A 5: 125,511,884 S409T probably damaging Het
Atf6 T C 1: 170,794,706 M449V probably benign Het
B4galt1 C T 4: 40,809,373 G332S probably benign Het
Bcl11a G T 11: 24,163,680 R341M probably damaging Het
Brf2 G A 8: 27,124,190 Q323* probably null Het
Bscl2 T C 19: 8,847,519 V322A probably benign Het
Btnl9 T C 11: 49,180,738 Y86C probably damaging Het
C4b T A 17: 34,742,380 I202F probably damaging Het
Cbfb T A 8: 105,194,593 probably null Het
Cc2d2b T A 19: 40,806,849 Y963N possibly damaging Het
Cep135 A T 5: 76,609,692 D391V possibly damaging Het
Col12a1 A G 9: 79,678,493 V1228A probably benign Het
Cr2 T A 1: 195,168,687 Y157F probably benign Het
Creg2 C T 1: 39,650,903 G13E probably benign Het
Cul5 G T 9: 53,624,166 A595E probably benign Het
Cyp4f16 A G 17: 32,546,747 E368G possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Eps15 G A 4: 109,315,872 D177N possibly damaging Het
Erbb4 C T 1: 68,259,209 R684H probably damaging Het
Ermp1 C T 19: 29,628,658 V419I probably benign Het
Foxi3 T C 6: 70,960,716 S311P probably benign Het
Fras1 C T 5: 96,739,318 A2653V probably damaging Het
Gbp3 A T 3: 142,567,612 N307Y probably damaging Het
Ggcx G A 6: 72,427,917 R436Q probably damaging Het
Gimap3 A T 6: 48,765,627 V123D probably benign Het
Gm14326 A T 2: 177,945,887 Y439N probably damaging Het
Gm4756 G T 12: 72,619,358 Q180K probably benign Het
Gm5591 A G 7: 38,521,914 S244P probably benign Het
Gm9507 A T 10: 77,811,537 C103S unknown Het
Guf1 G A 5: 69,561,159 V214I probably benign Het
Ido2 T C 8: 24,576,193 Y19C probably damaging Het
Idua T C 5: 108,680,583 S268P probably damaging Het
Igf1r T C 7: 68,190,101 Y719H probably damaging Het
Itgb4 A T 11: 115,982,699 probably null Het
Kctd19 T A 8: 105,385,058 T868S probably damaging Het
Lonrf2 A T 1: 38,800,762 H417Q probably benign Het
Lrp2 T C 2: 69,438,388 T4184A possibly damaging Het
Mapk15 T C 15: 75,996,446 F219S probably damaging Het
Myh7b A T 2: 155,625,966 Y808F probably benign Het
Myo19 T G 11: 84,885,710 F64C possibly damaging Het
Mysm1 A T 4: 94,961,765 V434D probably damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nbeal2 A T 9: 110,631,446 Y1780* probably null Het
Ndc80 A T 17: 71,496,301 M615K probably benign Het
Nfkbib C A 7: 28,766,263 V54F probably damaging Het
Npy5r A G 8: 66,681,752 F130L probably damaging Het
Nt5c3 T C 6: 56,883,042 E304G probably benign Het
Odaph A G 5: 91,994,699 D40G possibly damaging Het
Olfr1389 C T 11: 49,430,605 T43I probably benign Het
Olfr1469 T C 19: 13,410,818 M83T probably benign Het
Olfr695 T A 7: 106,714,442 K80* probably null Het
Olfr974 A T 9: 39,942,967 K236* probably null Het
Palm3 T A 8: 84,029,461 I534K probably benign Het
Pde10a A G 17: 8,929,132 N89S probably benign Het
Piezo1 T C 8: 122,496,444 K870E Het
Pik3c2g T C 6: 139,633,793 probably null Het
Pnpla6 T A 8: 3,531,737 Y662* probably null Het
Proser3 A T 7: 30,549,661 F2Y possibly damaging Het
Psma5 A G 3: 108,265,129 I54V probably benign Het
Qrich2 C A 11: 116,457,337 G887V probably damaging Het
Rdx A G 9: 52,065,901 D150G possibly damaging Het
Reln C T 5: 22,134,692 V221I probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Samd14 A G 11: 95,023,458 probably null Het
Scimp A T 11: 70,791,515 I125N possibly damaging Het
Sec23a A G 12: 58,992,247 F289L probably damaging Het
Sipa1l3 G A 7: 29,339,146 Q1408* probably null Het
Skor2 T C 18: 76,858,721 L46P unknown Het
Slc12a1 A T 2: 125,214,092 I848F possibly damaging Het
Slc47a1 A G 11: 61,363,403 L211P probably damaging Het
Slc7a10 T C 7: 35,195,129 V71A probably damaging Het
Smco1 C A 16: 32,274,047 Q179K possibly damaging Het
Smg1 A G 7: 118,143,322 L3223P possibly damaging Het
Smpdl3a T C 10: 57,801,045 S80P probably damaging Het
Spire2 A G 8: 123,332,987 R75G probably benign Het
Sptbn2 T A 19: 4,746,799 H1808Q probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Ssfa2 G T 2: 79,662,615 E1169* probably null Het
Supv3l1 T C 10: 62,445,081 D177G probably damaging Het
Syne1 C T 10: 5,264,738 E3215K probably damaging Het
Szt2 A G 4: 118,373,840 V2548A unknown Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Washc2 A G 6: 116,226,424 E384G possibly damaging Het
Other mutations in Zfp712
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Zfp712 APN 13 67042166 missense possibly damaging 0.55
IGL02148:Zfp712 APN 13 67042158 missense probably damaging 1.00
R0085:Zfp712 UTSW 13 67041192 missense probably benign 0.00
R0332:Zfp712 UTSW 13 67040813 missense probably damaging 1.00
R1676:Zfp712 UTSW 13 67052336 missense probably benign 0.00
R1838:Zfp712 UTSW 13 67042047 missense probably damaging 1.00
R1997:Zfp712 UTSW 13 67042050 nonsense probably null
R2147:Zfp712 UTSW 13 67041896 missense possibly damaging 0.94
R2203:Zfp712 UTSW 13 67041984 missense probably benign 0.32
R3421:Zfp712 UTSW 13 67052392 missense probably damaging 0.98
R3943:Zfp712 UTSW 13 67041332 missense probably benign 0.06
R4722:Zfp712 UTSW 13 67042113 missense probably benign 0.41
R4952:Zfp712 UTSW 13 67040841 missense possibly damaging 0.63
R4964:Zfp712 UTSW 13 67040612 missense probably damaging 1.00
R4966:Zfp712 UTSW 13 67040612 missense probably damaging 1.00
R4967:Zfp712 UTSW 13 67040709 nonsense probably null
R5114:Zfp712 UTSW 13 67041361 missense probably damaging 1.00
R5361:Zfp712 UTSW 13 67041015 missense possibly damaging 0.95
R5922:Zfp712 UTSW 13 67041604 missense probably benign 0.01
R5950:Zfp712 UTSW 13 67044817 missense probably damaging 0.99
R6004:Zfp712 UTSW 13 67041705 missense probably damaging 1.00
R6236:Zfp712 UTSW 13 67040621 missense probably damaging 1.00
R6298:Zfp712 UTSW 13 67041329 missense probably damaging 1.00
R6499:Zfp712 UTSW 13 67052336 missense probably benign 0.00
R6774:Zfp712 UTSW 13 67041504 missense probably benign 0.01
R6932:Zfp712 UTSW 13 67040827 nonsense probably null
R7410:Zfp712 UTSW 13 67041336 missense probably benign 0.00
R7831:Zfp712 UTSW 13 67052419 splice site probably null
R8144:Zfp712 UTSW 13 67041108 missense probably benign
R8298:Zfp712 UTSW 13 67040912 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAGAACACGTAAAAGCTTTGCC -3'
(R):5'- TGAAGTAATGTTCCACTGTTGTCAG -3'

Sequencing Primer
(F):5'- GCCACATTCTTTACATTTGTAGGG -3'
(R):5'- GCTGCAATAAATACAGTTATGGAACC -3'
Posted On2020-09-15