Incidental Mutation 'R7923:Pde10a'
ID648576
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Namephosphodiesterase 10A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7923 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location8525372-8986648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8929132 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 89 (N89S)
Ref Sequence ENSEMBL: ENSMUSP00000086485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
Predicted Effect probably benign
Transcript: ENSMUST00000024647
AA Change: N9S

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: N9S

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089085
AA Change: N89S

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: N89S

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115715
AA Change: N9S

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: N9S

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115717
AA Change: N89S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000115720
AA Change: N72S

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: N72S

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115724
AA Change: N143S

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: N143S

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149440
AA Change: N20S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: N20S

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000231430
AA Change: N371S

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C T 8: 72,444,911 T54M probably damaging Het
4932443I19Rik A C 8: 13,738,456 H140P unknown Het
Aacs T A 5: 125,511,884 S409T probably damaging Het
Atf6 T C 1: 170,794,706 M449V probably benign Het
B4galt1 C T 4: 40,809,373 G332S probably benign Het
Bcl11a G T 11: 24,163,680 R341M probably damaging Het
Brf2 G A 8: 27,124,190 Q323* probably null Het
Bscl2 T C 19: 8,847,519 V322A probably benign Het
Btnl9 T C 11: 49,180,738 Y86C probably damaging Het
C4b T A 17: 34,742,380 I202F probably damaging Het
Cbfb T A 8: 105,194,593 probably null Het
Cc2d2b T A 19: 40,806,849 Y963N possibly damaging Het
Cep135 A T 5: 76,609,692 D391V possibly damaging Het
Col12a1 A G 9: 79,678,493 V1228A probably benign Het
Cr2 T A 1: 195,168,687 Y157F probably benign Het
Creg2 C T 1: 39,650,903 G13E probably benign Het
Cul5 G T 9: 53,624,166 A595E probably benign Het
Cyp4f16 A G 17: 32,546,747 E368G possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Eps15 G A 4: 109,315,872 D177N possibly damaging Het
Erbb4 C T 1: 68,259,209 R684H probably damaging Het
Ermp1 C T 19: 29,628,658 V419I probably benign Het
Foxi3 T C 6: 70,960,716 S311P probably benign Het
Fras1 C T 5: 96,739,318 A2653V probably damaging Het
Gbp3 A T 3: 142,567,612 N307Y probably damaging Het
Ggcx G A 6: 72,427,917 R436Q probably damaging Het
Gimap3 A T 6: 48,765,627 V123D probably benign Het
Gm14326 A T 2: 177,945,887 Y439N probably damaging Het
Gm4756 G T 12: 72,619,358 Q180K probably benign Het
Gm5591 A G 7: 38,521,914 S244P probably benign Het
Gm9507 A T 10: 77,811,537 C103S unknown Het
Guf1 G A 5: 69,561,159 V214I probably benign Het
Ido2 T C 8: 24,576,193 Y19C probably damaging Het
Idua T C 5: 108,680,583 S268P probably damaging Het
Igf1r T C 7: 68,190,101 Y719H probably damaging Het
Itgb4 A T 11: 115,982,699 probably null Het
Kctd19 T A 8: 105,385,058 T868S probably damaging Het
Lonrf2 A T 1: 38,800,762 H417Q probably benign Het
Lrp2 T C 2: 69,438,388 T4184A possibly damaging Het
Mapk15 T C 15: 75,996,446 F219S probably damaging Het
Myh7b A T 2: 155,625,966 Y808F probably benign Het
Myo19 T G 11: 84,885,710 F64C possibly damaging Het
Mysm1 A T 4: 94,961,765 V434D probably damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nbeal2 A T 9: 110,631,446 Y1780* probably null Het
Ndc80 A T 17: 71,496,301 M615K probably benign Het
Nfkbib C A 7: 28,766,263 V54F probably damaging Het
Npy5r A G 8: 66,681,752 F130L probably damaging Het
Nt5c3 T C 6: 56,883,042 E304G probably benign Het
Odaph A G 5: 91,994,699 D40G possibly damaging Het
Olfr1389 C T 11: 49,430,605 T43I probably benign Het
Olfr1469 T C 19: 13,410,818 M83T probably benign Het
Olfr695 T A 7: 106,714,442 K80* probably null Het
Olfr974 A T 9: 39,942,967 K236* probably null Het
Palm3 T A 8: 84,029,461 I534K probably benign Het
Piezo1 T C 8: 122,496,444 K870E Het
Pik3c2g T C 6: 139,633,793 probably null Het
Pnpla6 T A 8: 3,531,737 Y662* probably null Het
Proser3 A T 7: 30,549,661 F2Y possibly damaging Het
Psma5 A G 3: 108,265,129 I54V probably benign Het
Qrich2 C A 11: 116,457,337 G887V probably damaging Het
Rdx A G 9: 52,065,901 D150G possibly damaging Het
Reln C T 5: 22,134,692 V221I probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Samd14 A G 11: 95,023,458 probably null Het
Scimp A T 11: 70,791,515 I125N possibly damaging Het
Sec23a A G 12: 58,992,247 F289L probably damaging Het
Sipa1l3 G A 7: 29,339,146 Q1408* probably null Het
Skor2 T C 18: 76,858,721 L46P unknown Het
Slc12a1 A T 2: 125,214,092 I848F possibly damaging Het
Slc47a1 A G 11: 61,363,403 L211P probably damaging Het
Slc7a10 T C 7: 35,195,129 V71A probably damaging Het
Smco1 C A 16: 32,274,047 Q179K possibly damaging Het
Smg1 A G 7: 118,143,322 L3223P possibly damaging Het
Smpdl3a T C 10: 57,801,045 S80P probably damaging Het
Spire2 A G 8: 123,332,987 R75G probably benign Het
Sptbn2 T A 19: 4,746,799 H1808Q probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Ssfa2 G T 2: 79,662,615 E1169* probably null Het
Supv3l1 T C 10: 62,445,081 D177G probably damaging Het
Syne1 C T 10: 5,264,738 E3215K probably damaging Het
Szt2 A G 4: 118,373,840 V2548A unknown Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Washc2 A G 6: 116,226,424 E384G possibly damaging Het
Zfp712 T A 13: 67,042,185 N93Y probably benign Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 8944970 missense probably damaging 1.00
IGL01762:Pde10a APN 17 8942918 missense possibly damaging 0.74
IGL01814:Pde10a APN 17 8929107 start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 8974769 missense probably damaging 1.00
IGL02386:Pde10a APN 17 8953804 missense possibly damaging 0.93
IGL02573:Pde10a APN 17 8961890 missense probably benign 0.38
IGL02583:Pde10a APN 17 8981630 missense probably benign 0.23
IGL02649:Pde10a APN 17 8953772 missense probably damaging 1.00
IGL02992:Pde10a APN 17 8949461 missense probably damaging 0.97
IGL03109:Pde10a APN 17 8929214 critical splice donor site probably null
Bride UTSW 17 8949430 missense possibly damaging 0.60
buzzed UTSW 17 8930537 missense probably damaging 1.00
Gracile UTSW 17 8961920 missense possibly damaging 0.63
nubile UTSW 17 8967462 missense probably damaging 1.00
thunderball UTSW 17 8969589 missense probably damaging 1.00
R0004:Pde10a UTSW 17 8981576 missense probably benign 0.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0650:Pde10a UTSW 17 8942965 missense probably damaging 1.00
R1173:Pde10a UTSW 17 8920546 splice site probably benign
R1386:Pde10a UTSW 17 8953742 missense probably damaging 1.00
R1458:Pde10a UTSW 17 8964708 missense probably damaging 0.98
R1598:Pde10a UTSW 17 8929144 missense probably damaging 1.00
R1661:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1665:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1883:Pde10a UTSW 17 8978944 missense possibly damaging 0.86
R1960:Pde10a UTSW 17 8942918 missense possibly damaging 0.74
R2005:Pde10a UTSW 17 8929091 critical splice acceptor site probably null
R2071:Pde10a UTSW 17 8961995 missense probably benign 0.22
R2121:Pde10a UTSW 17 8977215 missense probably damaging 1.00
R2376:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R3721:Pde10a UTSW 17 8969589 missense probably damaging 1.00
R3872:Pde10a UTSW 17 8757091 missense possibly damaging 0.92
R4627:Pde10a UTSW 17 8981652 missense probably damaging 1.00
R4652:Pde10a UTSW 17 8757053 missense possibly damaging 0.82
R5107:Pde10a UTSW 17 8944970 missense probably damaging 1.00
R5184:Pde10a UTSW 17 8977155 missense probably damaging 1.00
R5354:Pde10a UTSW 17 8961980 missense probably damaging 0.97
R5735:Pde10a UTSW 17 8941192 missense probably damaging 0.99
R5878:Pde10a UTSW 17 8949372 missense possibly damaging 0.85
R5921:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R6027:Pde10a UTSW 17 8964677 missense possibly damaging 0.78
R6145:Pde10a UTSW 17 8929117 missense probably damaging 1.00
R6279:Pde10a UTSW 17 8978957 missense probably damaging 0.99
R6409:Pde10a UTSW 17 8949438 missense probably damaging 1.00
R6870:Pde10a UTSW 17 8967524 missense possibly damaging 0.56
R6947:Pde10a UTSW 17 8969592 missense probably damaging 1.00
R7072:Pde10a UTSW 17 8943026 missense probably benign 0.40
R7084:Pde10a UTSW 17 8941162 missense probably benign 0.25
R7294:Pde10a UTSW 17 8757021 missense probably benign
R7339:Pde10a UTSW 17 8757028 missense probably benign 0.01
R7347:Pde10a UTSW 17 8967462 missense probably damaging 1.00
R7373:Pde10a UTSW 17 8942992 missense probably benign 0.00
R7481:Pde10a UTSW 17 8949430 missense possibly damaging 0.60
R7833:Pde10a UTSW 17 8961920 missense possibly damaging 0.63
R8053:Pde10a UTSW 17 8974772 missense probably benign 0.12
R8137:Pde10a UTSW 17 8974815 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCAGATAGTTCAGTTTCAAGTCTCC -3'
(R):5'- TGTTTCCACTTCAGACTGAGCC -3'

Sequencing Primer
(F):5'- AAGTCTCCCTGTTTTACAAGTGG -3'
(R):5'- TTCAGACTGAGCCCAGCAAC -3'
Posted On2020-09-15