Incidental Mutation 'R7923:Skor2'
ID648580
Institutional Source Beutler Lab
Gene Symbol Skor2
Ensembl Gene ENSMUSG00000091519
Gene NameSKI family transcriptional corepressor 2
SynonymsGm7348, Fussel18, Corl2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7923 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location76856405-76900342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76858721 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 46 (L46P)
Ref Sequence ENSEMBL: ENSMUSP00000132338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166956]
Predicted Effect unknown
Transcript: ENSMUST00000166956
AA Change: L46P
SMART Domains Protein: ENSMUSP00000132338
Gene: ENSMUSG00000091519
AA Change: L46P

DomainStartEndE-ValueType
Pfam:Ski_Sno 25 132 2.3e-41 PFAM
c-SKI_SMAD_bind 144 236 6.92e-55 SMART
low complexity region 261 305 N/A INTRINSIC
low complexity region 320 373 N/A INTRINSIC
low complexity region 426 452 N/A INTRINSIC
low complexity region 478 491 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
low complexity region 578 595 N/A INTRINSIC
low complexity region 645 680 N/A INTRINSIC
low complexity region 688 707 N/A INTRINSIC
low complexity region 722 741 N/A INTRINSIC
low complexity region 747 766 N/A INTRINSIC
low complexity region 817 838 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display neonatal and postnatal lethality, abnormal cerebellum development, and abnormal Purkinje cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C T 8: 72,444,911 T54M probably damaging Het
4932443I19Rik A C 8: 13,738,456 H140P unknown Het
Aacs T A 5: 125,511,884 S409T probably damaging Het
Atf6 T C 1: 170,794,706 M449V probably benign Het
B4galt1 C T 4: 40,809,373 G332S probably benign Het
Bcl11a G T 11: 24,163,680 R341M probably damaging Het
Brf2 G A 8: 27,124,190 Q323* probably null Het
Bscl2 T C 19: 8,847,519 V322A probably benign Het
Btnl9 T C 11: 49,180,738 Y86C probably damaging Het
C4b T A 17: 34,742,380 I202F probably damaging Het
Cbfb T A 8: 105,194,593 probably null Het
Cc2d2b T A 19: 40,806,849 Y963N possibly damaging Het
Cep135 A T 5: 76,609,692 D391V possibly damaging Het
Col12a1 A G 9: 79,678,493 V1228A probably benign Het
Cr2 T A 1: 195,168,687 Y157F probably benign Het
Creg2 C T 1: 39,650,903 G13E probably benign Het
Cul5 G T 9: 53,624,166 A595E probably benign Het
Cyp4f16 A G 17: 32,546,747 E368G possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Eps15 G A 4: 109,315,872 D177N possibly damaging Het
Erbb4 C T 1: 68,259,209 R684H probably damaging Het
Ermp1 C T 19: 29,628,658 V419I probably benign Het
Foxi3 T C 6: 70,960,716 S311P probably benign Het
Fras1 C T 5: 96,739,318 A2653V probably damaging Het
Gbp3 A T 3: 142,567,612 N307Y probably damaging Het
Ggcx G A 6: 72,427,917 R436Q probably damaging Het
Gimap3 A T 6: 48,765,627 V123D probably benign Het
Gm14326 A T 2: 177,945,887 Y439N probably damaging Het
Gm4756 G T 12: 72,619,358 Q180K probably benign Het
Gm5591 A G 7: 38,521,914 S244P probably benign Het
Gm9507 A T 10: 77,811,537 C103S unknown Het
Guf1 G A 5: 69,561,159 V214I probably benign Het
Ido2 T C 8: 24,576,193 Y19C probably damaging Het
Idua T C 5: 108,680,583 S268P probably damaging Het
Igf1r T C 7: 68,190,101 Y719H probably damaging Het
Itgb4 A T 11: 115,982,699 probably null Het
Kctd19 T A 8: 105,385,058 T868S probably damaging Het
Lonrf2 A T 1: 38,800,762 H417Q probably benign Het
Lrp2 T C 2: 69,438,388 T4184A possibly damaging Het
Mapk15 T C 15: 75,996,446 F219S probably damaging Het
Myh7b A T 2: 155,625,966 Y808F probably benign Het
Myo19 T G 11: 84,885,710 F64C possibly damaging Het
Mysm1 A T 4: 94,961,765 V434D probably damaging Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nbeal2 A T 9: 110,631,446 Y1780* probably null Het
Ndc80 A T 17: 71,496,301 M615K probably benign Het
Nfkbib C A 7: 28,766,263 V54F probably damaging Het
Npy5r A G 8: 66,681,752 F130L probably damaging Het
Nt5c3 T C 6: 56,883,042 E304G probably benign Het
Odaph A G 5: 91,994,699 D40G possibly damaging Het
Olfr1389 C T 11: 49,430,605 T43I probably benign Het
Olfr1469 T C 19: 13,410,818 M83T probably benign Het
Olfr695 T A 7: 106,714,442 K80* probably null Het
Olfr974 A T 9: 39,942,967 K236* probably null Het
Palm3 T A 8: 84,029,461 I534K probably benign Het
Pde10a A G 17: 8,929,132 N89S probably benign Het
Piezo1 T C 8: 122,496,444 K870E Het
Pik3c2g T C 6: 139,633,793 probably null Het
Pnpla6 T A 8: 3,531,737 Y662* probably null Het
Proser3 A T 7: 30,549,661 F2Y possibly damaging Het
Psma5 A G 3: 108,265,129 I54V probably benign Het
Qrich2 C A 11: 116,457,337 G887V probably damaging Het
Rdx A G 9: 52,065,901 D150G possibly damaging Het
Reln C T 5: 22,134,692 V221I probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Samd14 A G 11: 95,023,458 probably null Het
Scimp A T 11: 70,791,515 I125N possibly damaging Het
Sec23a A G 12: 58,992,247 F289L probably damaging Het
Sipa1l3 G A 7: 29,339,146 Q1408* probably null Het
Slc12a1 A T 2: 125,214,092 I848F possibly damaging Het
Slc47a1 A G 11: 61,363,403 L211P probably damaging Het
Slc7a10 T C 7: 35,195,129 V71A probably damaging Het
Smco1 C A 16: 32,274,047 Q179K possibly damaging Het
Smg1 A G 7: 118,143,322 L3223P possibly damaging Het
Smpdl3a T C 10: 57,801,045 S80P probably damaging Het
Spire2 A G 8: 123,332,987 R75G probably benign Het
Sptbn2 T A 19: 4,746,799 H1808Q probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Ssfa2 G T 2: 79,662,615 E1169* probably null Het
Supv3l1 T C 10: 62,445,081 D177G probably damaging Het
Syne1 C T 10: 5,264,738 E3215K probably damaging Het
Szt2 A G 4: 118,373,840 V2548A unknown Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Washc2 A G 6: 116,226,424 E384G possibly damaging Het
Zfp712 T A 13: 67,042,185 N93Y probably benign Het
Other mutations in Skor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Skor2 APN 18 76858667 missense unknown
IGL01604:Skor2 APN 18 76859951 missense possibly damaging 0.93
IGL02306:Skor2 APN 18 76862679 missense probably benign 0.01
IGL03287:Skor2 APN 18 76876135 missense probably damaging 0.99
R0225:Skor2 UTSW 18 76859098 missense unknown
R0265:Skor2 UTSW 18 76876598 missense probably damaging 0.99
R0650:Skor2 UTSW 18 76876560 missense probably benign 0.32
R1086:Skor2 UTSW 18 76859299 missense unknown
R1237:Skor2 UTSW 18 76876132 nonsense probably null
R1465:Skor2 UTSW 18 76876645 splice site probably benign
R1625:Skor2 UTSW 18 76858804 missense unknown
R1682:Skor2 UTSW 18 76859516 missense unknown
R1918:Skor2 UTSW 18 76859356 missense unknown
R2878:Skor2 UTSW 18 76860724 nonsense probably null
R3103:Skor2 UTSW 18 76859278 nonsense probably null
R3611:Skor2 UTSW 18 76858838 missense unknown
R3882:Skor2 UTSW 18 76862689 missense probably damaging 0.97
R3891:Skor2 UTSW 18 76858655 missense unknown
R4473:Skor2 UTSW 18 76859461 missense unknown
R4720:Skor2 UTSW 18 76861183 critical splice donor site probably null
R4828:Skor2 UTSW 18 76860418 missense probably damaging 1.00
R4906:Skor2 UTSW 18 76860295 missense possibly damaging 0.73
R5074:Skor2 UTSW 18 76858954 nonsense probably null
R5486:Skor2 UTSW 18 76858700 missense unknown
R5729:Skor2 UTSW 18 76858883 missense unknown
R5886:Skor2 UTSW 18 76859429 missense unknown
R6017:Skor2 UTSW 18 76858927 missense unknown
R6514:Skor2 UTSW 18 76862694 missense probably damaging 1.00
R6565:Skor2 UTSW 18 76859912 missense possibly damaging 0.70
R6909:Skor2 UTSW 18 76860557 missense possibly damaging 0.68
R7169:Skor2 UTSW 18 76860986 missense probably benign 0.04
R7171:Skor2 UTSW 18 76860986 missense probably benign 0.04
R7188:Skor2 UTSW 18 76859809 missense possibly damaging 0.53
R7219:Skor2 UTSW 18 76860401 missense possibly damaging 0.96
R7548:Skor2 UTSW 18 76860905 missense possibly damaging 0.82
R7722:Skor2 UTSW 18 76862644 missense probably benign 0.09
R8125:Skor2 UTSW 18 76859678 missense unknown
R8255:Skor2 UTSW 18 76858969 missense unknown
R8531:Skor2 UTSW 18 76858874 missense unknown
R8548:Skor2 UTSW 18 76858886 missense unknown
R8917:Skor2 UTSW 18 76860809 missense probably damaging 1.00
RF015:Skor2 UTSW 18 76860788 missense probably damaging 0.99
Z1176:Skor2 UTSW 18 76860124 missense probably benign 0.15
Z1176:Skor2 UTSW 18 76860670 missense possibly damaging 0.93
Z1176:Skor2 UTSW 18 76861161 missense probably damaging 0.99
Z1177:Skor2 UTSW 18 76876093 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CACCCCTCTGTCTTAAAACAGG -3'
(R):5'- AGGATCTCCAGTTGGACAGGTG -3'

Sequencing Primer
(F):5'- GGAAAGGTTCAAGTCAACTTTCTCC -3'
(R):5'- TCCAGTTGGACAGGTGTGCAC -3'
Posted On2020-09-15