Incidental Mutation 'R7934:Creb1'
ID 648588
Institutional Source Beutler Lab
Gene Symbol Creb1
Ensembl Gene ENSMUSG00000025958
Gene Name cAMP responsive element binding protein 1
Synonyms Creb, Creb-1, 2310001E10Rik, 3526402H21Rik
MMRRC Submission 045980-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.940) question?
Stock # R7934 (G1)
Quality Score 165.009
Status Not validated
Chromosome 1
Chromosomal Location 64571963-64643707 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 64609372 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 108 (A108T)
Ref Sequence ENSEMBL: ENSMUSP00000132860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049932] [ENSMUST00000087366] [ENSMUST00000171164] [ENSMUST00000185594] [ENSMUST00000187811] [ENSMUST00000190348] [ENSMUST00000190876]
AlphaFold Q01147
Predicted Effect probably benign
Transcript: ENSMUST00000049932
AA Change: A162T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000059973
Gene: ENSMUSG00000025958
AA Change: A162T

DomainStartEndE-ValueType
internal_repeat_1 16 89 5.16e-5 PROSPERO
Pfam:pKID 113 153 7.7e-24 PFAM
low complexity region 162 174 N/A INTRINSIC
internal_repeat_1 184 260 5.16e-5 PROSPERO
BRLZ 281 339 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087366
AA Change: A148T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000084624
Gene: ENSMUSG00000025958
AA Change: A148T

DomainStartEndE-ValueType
internal_repeat_1 16 90 1.46e-5 PROSPERO
Pfam:pKID 99 141 5.3e-24 PFAM
low complexity region 148 160 N/A INTRINSIC
internal_repeat_1 170 247 1.46e-5 PROSPERO
BRLZ 267 325 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171164
AA Change: A108T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000132860
Gene: ENSMUSG00000025958
AA Change: A108T

DomainStartEndE-ValueType
Pfam:pKID 59 101 9e-24 PFAM
low complexity region 108 120 N/A INTRINSIC
BRLZ 227 285 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185594
AA Change: A148T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139995
Gene: ENSMUSG00000025958
AA Change: A148T

DomainStartEndE-ValueType
internal_repeat_1 16 90 1.46e-5 PROSPERO
Pfam:pKID 99 141 5.3e-24 PFAM
low complexity region 148 160 N/A INTRINSIC
internal_repeat_1 170 247 1.46e-5 PROSPERO
BRLZ 267 325 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187811
AA Change: A148T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000140649
Gene: ENSMUSG00000025958
AA Change: A148T

DomainStartEndE-ValueType
Pfam:pKID 99 141 3.8e-21 PFAM
low complexity region 148 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190348
AA Change: A162T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140112
Gene: ENSMUSG00000025958
AA Change: A162T

DomainStartEndE-ValueType
internal_repeat_1 16 89 5.16e-5 PROSPERO
Pfam:pKID 113 155 1.2e-23 PFAM
low complexity region 162 174 N/A INTRINSIC
internal_repeat_1 184 260 5.16e-5 PROSPERO
BRLZ 281 339 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190876
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for alleles lacking some or all isotypes exhibit a range of defects involving circadian rhythms, axonal growth, sensory neuron survival, long-term memory, fear conditioning, body size, respiration, and neonatal viability. [provided by MGI curators]
Allele List at MGI

All alleles(85) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(76)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,349,770 (GRCm39) A93V probably benign Het
Abca8b G A 11: 109,865,865 (GRCm39) T296I possibly damaging Het
Adamtsl1 A C 4: 86,161,962 (GRCm39) Y365S probably damaging Het
Ambp T A 4: 63,067,677 (GRCm39) I178F probably damaging Het
Ankle1 T C 8: 71,858,899 (GRCm39) V44A possibly damaging Het
Arhgef2 A G 3: 88,537,221 (GRCm39) E37G probably damaging Het
Atp2a2 A G 5: 122,599,639 (GRCm39) I584T probably benign Het
Ccdc171 T A 4: 83,614,492 (GRCm39) L1031* probably null Het
Cdh17 T A 4: 11,799,754 (GRCm39) probably null Het
Cdip1 T C 16: 4,586,422 (GRCm39) T203A probably benign Het
Ceacam1 C T 7: 25,163,220 (GRCm39) V338I possibly damaging Het
Cep78 G A 19: 15,933,754 (GRCm39) T608I probably damaging Het
Ces3a T A 8: 105,775,345 (GRCm39) probably null Het
Cfap210 G A 2: 69,612,450 (GRCm39) Q97* probably null Het
Chd7 A G 4: 8,854,121 (GRCm39) T1898A probably benign Het
Cpne6 T C 14: 55,750,066 (GRCm39) C66R possibly damaging Het
Ctnna3 A T 10: 64,421,747 (GRCm39) I514F probably damaging Het
Cyp2c55 T C 19: 39,030,535 (GRCm39) F456L probably damaging Het
Cyp2d40 A G 15: 82,648,212 (GRCm39) S34P probably damaging Het
Cyp2g1 A T 7: 26,518,618 (GRCm39) T378S probably damaging Het
Eif2b3 C A 4: 116,923,675 (GRCm39) Q297K probably benign Het
Fbll1 T C 11: 35,689,048 (GRCm39) N72D unknown Het
Fev C G 1: 74,921,632 (GRCm39) R106P probably damaging Het
Gal3st1 A G 11: 3,948,405 (GRCm39) Y204C probably damaging Het
Gm15130 A T 2: 110,964,582 (GRCm39) L180Q Het
Greb1l A T 18: 10,474,371 (GRCm39) K229* probably null Het
Haghl G T 17: 26,002,519 (GRCm39) T214K probably damaging Het
Hivep1 A G 13: 42,308,174 (GRCm39) H138R probably benign Het
Ighv1-53 G T 12: 115,122,236 (GRCm39) Y46* probably null Het
Igsf21 T C 4: 139,761,755 (GRCm39) T308A possibly damaging Het
Kcnb1 A G 2: 166,946,536 (GRCm39) S771P probably benign Het
Kndc1 T A 7: 139,501,402 (GRCm39) M897K probably benign Het
Macf1 T C 4: 123,367,727 (GRCm39) M2345V possibly damaging Het
Mettl2 T C 11: 105,019,773 (GRCm39) S137P probably benign Het
Mrpl15 A G 1: 4,844,725 (GRCm39) S189P probably benign Het
Ndrg2 T C 14: 52,143,661 (GRCm39) Q351R probably benign Het
Nox4 A G 7: 86,945,032 (GRCm39) N65S probably damaging Het
Or1n1 A G 2: 36,750,228 (GRCm39) I44T possibly damaging Het
Or1p1b C T 11: 74,131,326 (GRCm39) S312F probably benign Het
Osbpl11 T A 16: 33,056,752 (GRCm39) W729R probably damaging Het
Oxct2b C A 4: 123,010,447 (GRCm39) C122* probably null Het
Pdcl3 A T 1: 39,026,782 (GRCm39) probably benign Het
Plcg1 A G 2: 160,616,498 (GRCm39) H1294R possibly damaging Het
Pnp2 C A 14: 51,201,903 (GRCm39) S296R probably benign Het
Ppp1r12c G A 7: 4,488,416 (GRCm39) Q337* probably null Het
Prr23a4 A G 9: 98,785,880 (GRCm39) R182G possibly damaging Het
Ranbp2 G A 10: 58,312,297 (GRCm39) V1006I probably damaging Het
Rxrg A G 1: 167,454,927 (GRCm39) D170G probably damaging Het
Sf3b3 T C 8: 111,548,162 (GRCm39) T691A probably benign Het
Slc1a4 A G 11: 20,258,518 (GRCm39) I307T probably damaging Het
Slc4a8 G A 15: 100,685,173 (GRCm39) V235I probably damaging Het
Srgap3 T A 6: 112,708,450 (GRCm39) I750F probably damaging Het
Trim30a A T 7: 104,061,448 (GRCm39) L282Q probably damaging Het
Tshr A G 12: 91,478,702 (GRCm39) K183R possibly damaging Het
Usp38 A T 8: 81,711,077 (GRCm39) L986Q probably damaging Het
Vmn1r257 T A 7: 22,391,439 (GRCm39) T102S possibly damaging Het
Vps18 A G 2: 119,124,122 (GRCm39) T350A probably benign Het
Zan T A 5: 137,461,841 (GRCm39) T1113S unknown Het
Zbtb37 A T 1: 160,857,305 (GRCm39) S312R probably damaging Het
Zeb1 A G 18: 5,748,703 (GRCm39) N90S probably benign Het
Zfp715 A T 7: 42,949,308 (GRCm39) Y217* probably null Het
Zfp9 T C 6: 118,441,847 (GRCm39) T272A probably damaging Het
Zfp943 T A 17: 22,212,361 (GRCm39) H482Q probably damaging Het
Zfp971 A T 2: 177,675,173 (GRCm39) K257N probably benign Het
Other mutations in Creb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Creb1 APN 1 64,609,284 (GRCm39) splice site probably benign
IGL01991:Creb1 APN 1 64,598,913 (GRCm39) missense probably benign
IGL03137:Creb1 APN 1 64,615,374 (GRCm39) missense possibly damaging 0.95
IGL03408:Creb1 APN 1 64,615,491 (GRCm39) splice site probably null
1mM(1):Creb1 UTSW 1 64,613,330 (GRCm39) nonsense probably null
R0028:Creb1 UTSW 1 64,609,307 (GRCm39) missense probably damaging 0.96
R0069:Creb1 UTSW 1 64,615,367 (GRCm39) missense possibly damaging 0.91
R0069:Creb1 UTSW 1 64,615,367 (GRCm39) missense possibly damaging 0.91
R0506:Creb1 UTSW 1 64,609,426 (GRCm39) missense probably damaging 1.00
R1834:Creb1 UTSW 1 64,590,109 (GRCm39) nonsense probably null
R1835:Creb1 UTSW 1 64,590,109 (GRCm39) nonsense probably null
R1836:Creb1 UTSW 1 64,590,109 (GRCm39) nonsense probably null
R7254:Creb1 UTSW 1 64,615,436 (GRCm39) nonsense probably null
R7716:Creb1 UTSW 1 64,605,420 (GRCm39) missense possibly damaging 0.94
R8275:Creb1 UTSW 1 64,597,687 (GRCm39) missense probably benign 0.20
R9005:Creb1 UTSW 1 64,605,478 (GRCm39) critical splice donor site probably null
R9431:Creb1 UTSW 1 64,615,413 (GRCm39) missense probably damaging 0.99
R9758:Creb1 UTSW 1 64,598,909 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAATTCTTGCATTTGAAGTTCCTGC -3'
(R):5'- TGTCTGACAGTAGGGCAAACAATATTG -3'

Sequencing Primer
(F):5'- CATTTGAAGTTCCTGCTTTGTTTG -3'
(R):5'- GCAAACAATATTGGCAGCAAAAGC -3'
Posted On 2020-09-15