Incidental Mutation 'R7934:Zfp971'
ID648598
Institutional Source Beutler Lab
Gene Symbol Zfp971
Ensembl Gene ENSMUSG00000074519
Gene Namezinc finger protein 971
SynonymsEtohi1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7934 (G1)
Quality Score90.0077
Status Not validated
Chromosome2
Chromosomal Location178023284-178034022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 178033380 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 257 (K257N)
Ref Sequence ENSEMBL: ENSMUSP00000104554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108925] [ENSMUST00000108926]
Predicted Effect probably benign
Transcript: ENSMUST00000108925
SMART Domains Protein: ENSMUSP00000104553
Gene: ENSMUSG00000074519

DomainStartEndE-ValueType
KRAB 4 64 1.2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108926
AA Change: K257N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104554
Gene: ENSMUSG00000074519
AA Change: K257N

DomainStartEndE-ValueType
KRAB 4 66 1.6e-13 SMART
ZnF_C2H2 78 97 1.38e2 SMART
ZnF_C2H2 103 125 4.38e1 SMART
ZnF_C2H2 131 153 1.92e-2 SMART
ZnF_C2H2 159 181 4.79e-3 SMART
ZnF_C2H2 187 209 2.36e-2 SMART
ZnF_C2H2 215 237 2.36e-2 SMART
ZnF_C2H2 243 265 3.69e-4 SMART
ZnF_C2H2 271 293 4.87e-4 SMART
ZnF_C2H2 299 321 4.4e-2 SMART
ZnF_C2H2 327 349 4.61e-5 SMART
ZnF_C2H2 355 377 4.94e-5 SMART
ZnF_C2H2 383 405 3.21e-4 SMART
ZnF_C2H2 411 433 4.47e-3 SMART
ZnF_C2H2 439 461 5.99e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,015 A93V probably benign Het
7420426K07Rik A G 9: 98,903,827 R182G possibly damaging Het
Abca8b G A 11: 109,975,039 T296I possibly damaging Het
Adamtsl1 A C 4: 86,243,725 Y365S probably damaging Het
Ambp T A 4: 63,149,440 I178F probably damaging Het
Ankle1 T C 8: 71,406,255 V44A possibly damaging Het
Arhgef2 A G 3: 88,629,914 E37G probably damaging Het
Atp2a2 A G 5: 122,461,576 I584T probably benign Het
Ccdc171 T A 4: 83,696,255 L1031* probably null Het
Ccdc173 G A 2: 69,782,106 Q97* probably null Het
Cdh17 T A 4: 11,799,754 probably null Het
Cdip1 T C 16: 4,768,558 T203A probably benign Het
Ceacam1 C T 7: 25,463,795 V338I possibly damaging Het
Cep78 G A 19: 15,956,390 T608I probably damaging Het
Ces3a T A 8: 105,048,713 probably null Het
Chd7 A G 4: 8,854,121 T1898A probably benign Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Creb1 G A 1: 64,570,213 A108T probably benign Het
Ctnna3 A T 10: 64,585,968 I514F probably damaging Het
Cyp2c55 T C 19: 39,042,091 F456L probably damaging Het
Cyp2d40 A G 15: 82,764,011 S34P probably damaging Het
Cyp2g1 A T 7: 26,819,193 T378S probably damaging Het
Eif2b3 C A 4: 117,066,478 Q297K probably benign Het
Fbll1 T C 11: 35,798,221 N72D unknown Het
Fev C G 1: 74,882,473 R106P probably damaging Het
Gal3st1 A G 11: 3,998,405 Y204C probably damaging Het
Gm15130 A T 2: 111,134,237 L180Q Het
Gm8693 T A 7: 22,692,014 T102S possibly damaging Het
Greb1l A T 18: 10,474,371 K229* probably null Het
Haghl G T 17: 25,783,545 T214K probably damaging Het
Hivep1 A G 13: 42,154,698 H138R probably benign Het
Ighv1-53 G T 12: 115,158,616 Y46* probably null Het
Igsf21 T C 4: 140,034,444 T308A possibly damaging Het
Kcnb1 A G 2: 167,104,616 S771P probably benign Het
Kndc1 T A 7: 139,921,486 M897K probably benign Het
Macf1 T C 4: 123,473,934 M2345V possibly damaging Het
Mettl2 T C 11: 105,128,947 S137P probably benign Het
Mrpl15 A G 1: 4,774,502 S189P probably benign Het
Ndrg2 T C 14: 51,906,204 Q351R probably benign Het
Nox4 A G 7: 87,295,824 N65S probably damaging Het
Olfr351 A G 2: 36,860,216 I44T possibly damaging Het
Olfr404-ps1 C T 11: 74,240,500 S312F probably benign Het
Osbpl11 T A 16: 33,236,382 W729R probably damaging Het
Oxct2b C A 4: 123,116,654 C122* probably null Het
Pdcl3 A T 1: 38,987,701 probably benign Het
Plcg1 A G 2: 160,774,578 H1294R possibly damaging Het
Pnp2 C A 14: 50,964,446 S296R probably benign Het
Ppp1r12c G A 7: 4,485,417 Q337* probably null Het
Ranbp2 G A 10: 58,476,475 V1006I probably damaging Het
Rxrg A G 1: 167,627,358 D170G probably damaging Het
Sf3b3 T C 8: 110,821,530 T691A probably benign Het
Slc1a4 A G 11: 20,308,518 I307T probably damaging Het
Slc4a8 G A 15: 100,787,292 V235I probably damaging Het
Srgap3 T A 6: 112,731,489 I750F probably damaging Het
Trim30a A T 7: 104,412,241 L282Q probably damaging Het
Tshr A G 12: 91,511,928 K183R possibly damaging Het
Usp38 A T 8: 80,984,448 L986Q probably damaging Het
Vps18 A G 2: 119,293,641 T350A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zbtb37 A T 1: 161,029,735 S312R probably damaging Het
Zeb1 A G 18: 5,748,703 N90S probably benign Het
Zfp715 A T 7: 43,299,884 Y217* probably null Het
Zfp9 T C 6: 118,464,886 T272A probably damaging Het
Zfp943 T A 17: 21,993,380 H482Q probably damaging Het
Other mutations in Zfp971
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Zfp971 APN 2 178023382 critical splice donor site probably null
R1108:Zfp971 UTSW 2 178033670 missense probably damaging 1.00
R1759:Zfp971 UTSW 2 178033929 missense probably damaging 0.99
R2183:Zfp971 UTSW 2 178033740 missense probably damaging 1.00
R2343:Zfp971 UTSW 2 178032994 missense possibly damaging 0.84
R4873:Zfp971 UTSW 2 178033147 missense probably benign 0.24
R4875:Zfp971 UTSW 2 178033147 missense probably benign 0.24
R5263:Zfp971 UTSW 2 178033762 missense probably damaging 1.00
R5396:Zfp971 UTSW 2 178033733 missense probably damaging 1.00
R6150:Zfp971 UTSW 2 178033454 missense probably benign 0.26
R6693:Zfp971 UTSW 2 178033431 missense probably benign 0.01
R6811:Zfp971 UTSW 2 178033881 missense possibly damaging 0.62
R7427:Zfp971 UTSW 2 178033174 missense probably damaging 1.00
R7428:Zfp971 UTSW 2 178033174 missense probably damaging 1.00
R7594:Zfp971 UTSW 2 178034000 missense possibly damaging 0.47
R7790:Zfp971 UTSW 2 178033499 missense probably damaging 0.96
R7796:Zfp971 UTSW 2 178031610 missense probably benign 0.00
R7990:Zfp971 UTSW 2 178033568 missense probably damaging 1.00
R8671:Zfp971 UTSW 2 178033937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTTTGCACAAAGCTGTCA -3'
(R):5'- TTGCAAAGGCTTTACCACATTG -3'

Sequencing Primer
(F):5'- GCAGTAAGCAGTCATCTCGGAATC -3'
(R):5'- GGTCACTACTGCTTGCAAAG -3'
Posted On2020-09-15