Incidental Mutation 'R7934:Chd7'
ID 648600
Institutional Source Beutler Lab
Gene Symbol Chd7
Ensembl Gene ENSMUSG00000041235
Gene Name chromodomain helicase DNA binding protein 7
Synonyms Whi, Dz, Cyn, GENA 47, Cycn, Lda, Flo, Obt, Edy, A730019I05Rik, Todo, GENA 60, WBE1, Gena 52, Mt
MMRRC Submission 045980-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R7934 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 8690406-8867659 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8854121 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1898 (T1898A)
Ref Sequence ENSEMBL: ENSMUSP00000043903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000170391]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039267
AA Change: T1898A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235
AA Change: T1898A

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051558
AA Change: T1898A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235
AA Change: T1898A

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170391
SMART Domains Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
BRK 586 630 3.77e-23 SMART
low complexity region 670 680 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 724 733 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 765 776 N/A INTRINSIC
low complexity region 852 871 N/A INTRINSIC
low complexity region 922 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222546
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,349,770 (GRCm39) A93V probably benign Het
Abca8b G A 11: 109,865,865 (GRCm39) T296I possibly damaging Het
Adamtsl1 A C 4: 86,161,962 (GRCm39) Y365S probably damaging Het
Ambp T A 4: 63,067,677 (GRCm39) I178F probably damaging Het
Ankle1 T C 8: 71,858,899 (GRCm39) V44A possibly damaging Het
Arhgef2 A G 3: 88,537,221 (GRCm39) E37G probably damaging Het
Atp2a2 A G 5: 122,599,639 (GRCm39) I584T probably benign Het
Ccdc171 T A 4: 83,614,492 (GRCm39) L1031* probably null Het
Cdh17 T A 4: 11,799,754 (GRCm39) probably null Het
Cdip1 T C 16: 4,586,422 (GRCm39) T203A probably benign Het
Ceacam1 C T 7: 25,163,220 (GRCm39) V338I possibly damaging Het
Cep78 G A 19: 15,933,754 (GRCm39) T608I probably damaging Het
Ces3a T A 8: 105,775,345 (GRCm39) probably null Het
Cfap210 G A 2: 69,612,450 (GRCm39) Q97* probably null Het
Cpne6 T C 14: 55,750,066 (GRCm39) C66R possibly damaging Het
Creb1 G A 1: 64,609,372 (GRCm39) A108T probably benign Het
Ctnna3 A T 10: 64,421,747 (GRCm39) I514F probably damaging Het
Cyp2c55 T C 19: 39,030,535 (GRCm39) F456L probably damaging Het
Cyp2d40 A G 15: 82,648,212 (GRCm39) S34P probably damaging Het
Cyp2g1 A T 7: 26,518,618 (GRCm39) T378S probably damaging Het
Eif2b3 C A 4: 116,923,675 (GRCm39) Q297K probably benign Het
Fbll1 T C 11: 35,689,048 (GRCm39) N72D unknown Het
Fev C G 1: 74,921,632 (GRCm39) R106P probably damaging Het
Gal3st1 A G 11: 3,948,405 (GRCm39) Y204C probably damaging Het
Gm15130 A T 2: 110,964,582 (GRCm39) L180Q Het
Greb1l A T 18: 10,474,371 (GRCm39) K229* probably null Het
Haghl G T 17: 26,002,519 (GRCm39) T214K probably damaging Het
Hivep1 A G 13: 42,308,174 (GRCm39) H138R probably benign Het
Ighv1-53 G T 12: 115,122,236 (GRCm39) Y46* probably null Het
Igsf21 T C 4: 139,761,755 (GRCm39) T308A possibly damaging Het
Kcnb1 A G 2: 166,946,536 (GRCm39) S771P probably benign Het
Kndc1 T A 7: 139,501,402 (GRCm39) M897K probably benign Het
Macf1 T C 4: 123,367,727 (GRCm39) M2345V possibly damaging Het
Mettl2 T C 11: 105,019,773 (GRCm39) S137P probably benign Het
Mrpl15 A G 1: 4,844,725 (GRCm39) S189P probably benign Het
Ndrg2 T C 14: 52,143,661 (GRCm39) Q351R probably benign Het
Nox4 A G 7: 86,945,032 (GRCm39) N65S probably damaging Het
Or1n1 A G 2: 36,750,228 (GRCm39) I44T possibly damaging Het
Or1p1b C T 11: 74,131,326 (GRCm39) S312F probably benign Het
Osbpl11 T A 16: 33,056,752 (GRCm39) W729R probably damaging Het
Oxct2b C A 4: 123,010,447 (GRCm39) C122* probably null Het
Pdcl3 A T 1: 39,026,782 (GRCm39) probably benign Het
Plcg1 A G 2: 160,616,498 (GRCm39) H1294R possibly damaging Het
Pnp2 C A 14: 51,201,903 (GRCm39) S296R probably benign Het
Ppp1r12c G A 7: 4,488,416 (GRCm39) Q337* probably null Het
Prr23a4 A G 9: 98,785,880 (GRCm39) R182G possibly damaging Het
Ranbp2 G A 10: 58,312,297 (GRCm39) V1006I probably damaging Het
Rxrg A G 1: 167,454,927 (GRCm39) D170G probably damaging Het
Sf3b3 T C 8: 111,548,162 (GRCm39) T691A probably benign Het
Slc1a4 A G 11: 20,258,518 (GRCm39) I307T probably damaging Het
Slc4a8 G A 15: 100,685,173 (GRCm39) V235I probably damaging Het
Srgap3 T A 6: 112,708,450 (GRCm39) I750F probably damaging Het
Trim30a A T 7: 104,061,448 (GRCm39) L282Q probably damaging Het
Tshr A G 12: 91,478,702 (GRCm39) K183R possibly damaging Het
Usp38 A T 8: 81,711,077 (GRCm39) L986Q probably damaging Het
Vmn1r257 T A 7: 22,391,439 (GRCm39) T102S possibly damaging Het
Vps18 A G 2: 119,124,122 (GRCm39) T350A probably benign Het
Zan T A 5: 137,461,841 (GRCm39) T1113S unknown Het
Zbtb37 A T 1: 160,857,305 (GRCm39) S312R probably damaging Het
Zeb1 A G 18: 5,748,703 (GRCm39) N90S probably benign Het
Zfp715 A T 7: 42,949,308 (GRCm39) Y217* probably null Het
Zfp9 T C 6: 118,441,847 (GRCm39) T272A probably damaging Het
Zfp943 T A 17: 22,212,361 (GRCm39) H482Q probably damaging Het
Zfp971 A T 2: 177,675,173 (GRCm39) K257N probably benign Het
Other mutations in Chd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Chd7 APN 4 8,859,106 (GRCm39) missense probably damaging 1.00
IGL00510:Chd7 APN 4 8,801,404 (GRCm39) missense probably damaging 1.00
IGL00741:Chd7 APN 4 8,839,454 (GRCm39) missense probably damaging 1.00
IGL00796:Chd7 APN 4 8,847,271 (GRCm39) missense possibly damaging 0.95
IGL00907:Chd7 APN 4 8,840,435 (GRCm39) missense probably damaging 0.98
IGL00930:Chd7 APN 4 8,805,181 (GRCm39) missense probably damaging 1.00
IGL01542:Chd7 APN 4 8,859,285 (GRCm39) missense possibly damaging 0.71
IGL01602:Chd7 APN 4 8,833,834 (GRCm39) missense probably damaging 1.00
IGL01605:Chd7 APN 4 8,833,834 (GRCm39) missense probably damaging 1.00
IGL01670:Chd7 APN 4 8,827,033 (GRCm39) missense probably damaging 0.98
IGL02434:Chd7 APN 4 8,752,145 (GRCm39) missense probably benign 0.00
IGL02531:Chd7 APN 4 8,854,134 (GRCm39) missense probably damaging 1.00
IGL02626:Chd7 APN 4 8,826,519 (GRCm39) missense probably damaging 1.00
IGL02961:Chd7 APN 4 8,751,542 (GRCm39) missense probably damaging 1.00
IGL02972:Chd7 APN 4 8,855,174 (GRCm39) missense probably benign 0.30
IGL03329:Chd7 APN 4 8,841,108 (GRCm39) missense probably damaging 1.00
Fili UTSW 4 8,839,523 (GRCm39) missense probably damaging 1.00
D4043:Chd7 UTSW 4 8,862,650 (GRCm39) missense probably damaging 1.00
IGL02991:Chd7 UTSW 4 8,828,398 (GRCm39) missense possibly damaging 0.91
PIT4466001:Chd7 UTSW 4 8,753,101 (GRCm39) missense unknown
PIT4472001:Chd7 UTSW 4 8,753,101 (GRCm39) missense unknown
R0157:Chd7 UTSW 4 8,833,759 (GRCm39) missense probably damaging 1.00
R0179:Chd7 UTSW 4 8,862,516 (GRCm39) missense probably benign 0.22
R0240:Chd7 UTSW 4 8,852,670 (GRCm39) unclassified probably benign
R0388:Chd7 UTSW 4 8,854,560 (GRCm39) missense probably benign 0.27
R0462:Chd7 UTSW 4 8,850,821 (GRCm39) missense probably damaging 1.00
R0512:Chd7 UTSW 4 8,805,139 (GRCm39) intron probably benign
R0657:Chd7 UTSW 4 8,753,141 (GRCm39) missense probably damaging 1.00
R0799:Chd7 UTSW 4 8,801,310 (GRCm39) intron probably benign
R0885:Chd7 UTSW 4 8,866,432 (GRCm39) missense probably damaging 1.00
R1056:Chd7 UTSW 4 8,822,402 (GRCm39) missense possibly damaging 0.50
R1086:Chd7 UTSW 4 8,866,458 (GRCm39) missense probably benign 0.04
R1353:Chd7 UTSW 4 8,839,556 (GRCm39) missense probably damaging 0.99
R1466:Chd7 UTSW 4 8,840,561 (GRCm39) splice site probably null
R1466:Chd7 UTSW 4 8,840,561 (GRCm39) splice site probably null
R1605:Chd7 UTSW 4 8,844,675 (GRCm39) missense probably damaging 1.00
R1693:Chd7 UTSW 4 8,864,307 (GRCm39) critical splice donor site probably null
R1695:Chd7 UTSW 4 8,833,960 (GRCm39) missense probably damaging 1.00
R1938:Chd7 UTSW 4 8,847,200 (GRCm39) missense probably damaging 1.00
R1964:Chd7 UTSW 4 8,865,978 (GRCm39) missense probably damaging 0.96
R2020:Chd7 UTSW 4 8,855,226 (GRCm39) missense probably benign 0.00
R2134:Chd7 UTSW 4 8,753,147 (GRCm39) missense probably damaging 0.99
R2171:Chd7 UTSW 4 8,752,424 (GRCm39) missense probably damaging 1.00
R2271:Chd7 UTSW 4 8,785,532 (GRCm39) missense probably damaging 1.00
R2300:Chd7 UTSW 4 8,855,241 (GRCm39) missense probably benign 0.02
R2355:Chd7 UTSW 4 8,801,350 (GRCm39) missense possibly damaging 0.95
R3153:Chd7 UTSW 4 8,855,174 (GRCm39) missense probably benign 0.30
R3430:Chd7 UTSW 4 8,844,517 (GRCm39) missense probably damaging 0.99
R3746:Chd7 UTSW 4 8,752,537 (GRCm39) missense probably damaging 1.00
R4118:Chd7 UTSW 4 8,865,831 (GRCm39) missense probably damaging 1.00
R4119:Chd7 UTSW 4 8,785,658 (GRCm39) intron probably benign
R4332:Chd7 UTSW 4 8,854,143 (GRCm39) missense probably damaging 1.00
R4402:Chd7 UTSW 4 8,866,353 (GRCm39) missense possibly damaging 0.61
R4571:Chd7 UTSW 4 8,866,217 (GRCm39) missense probably benign 0.09
R4722:Chd7 UTSW 4 8,822,445 (GRCm39) missense probably damaging 1.00
R4821:Chd7 UTSW 4 8,844,706 (GRCm39) missense probably damaging 1.00
R4894:Chd7 UTSW 4 8,838,629 (GRCm39) missense probably damaging 0.99
R5205:Chd7 UTSW 4 8,752,509 (GRCm39) missense possibly damaging 0.60
R5344:Chd7 UTSW 4 8,844,417 (GRCm39) missense probably damaging 1.00
R5484:Chd7 UTSW 4 8,828,258 (GRCm39) missense probably damaging 1.00
R5578:Chd7 UTSW 4 8,847,149 (GRCm39) missense probably benign 0.09
R5583:Chd7 UTSW 4 8,752,473 (GRCm39) missense probably damaging 1.00
R5888:Chd7 UTSW 4 8,866,382 (GRCm39) missense probably damaging 0.98
R5905:Chd7 UTSW 4 8,840,553 (GRCm39) missense possibly damaging 0.91
R6091:Chd7 UTSW 4 8,751,875 (GRCm39) missense probably damaging 0.99
R6126:Chd7 UTSW 4 8,826,482 (GRCm39) missense probably damaging 1.00
R6399:Chd7 UTSW 4 8,828,274 (GRCm39) missense probably damaging 1.00
R6751:Chd7 UTSW 4 8,833,866 (GRCm39) missense probably damaging 1.00
R6810:Chd7 UTSW 4 8,839,523 (GRCm39) missense probably damaging 1.00
R6868:Chd7 UTSW 4 8,811,501 (GRCm39) splice site probably null
R6952:Chd7 UTSW 4 8,856,797 (GRCm39) missense probably damaging 1.00
R6986:Chd7 UTSW 4 8,859,285 (GRCm39) missense possibly damaging 0.71
R6990:Chd7 UTSW 4 8,844,525 (GRCm39) missense probably benign 0.28
R7139:Chd7 UTSW 4 8,865,865 (GRCm39) missense probably benign 0.00
R7288:Chd7 UTSW 4 8,847,093 (GRCm39) missense possibly damaging 0.92
R7355:Chd7 UTSW 4 8,752,196 (GRCm39) missense unknown
R7452:Chd7 UTSW 4 8,854,731 (GRCm39) missense probably benign 0.03
R7471:Chd7 UTSW 4 8,859,197 (GRCm39) missense probably damaging 0.96
R7588:Chd7 UTSW 4 8,864,039 (GRCm39) missense probably damaging 1.00
R7711:Chd7 UTSW 4 8,805,234 (GRCm39) missense probably benign 0.00
R7744:Chd7 UTSW 4 8,862,485 (GRCm39) splice site probably null
R7842:Chd7 UTSW 4 8,854,115 (GRCm39) missense probably benign 0.01
R7883:Chd7 UTSW 4 8,826,504 (GRCm39) missense probably damaging 1.00
R7983:Chd7 UTSW 4 8,844,609 (GRCm39) missense possibly damaging 0.47
R7983:Chd7 UTSW 4 8,752,628 (GRCm39) missense unknown
R8022:Chd7 UTSW 4 8,751,605 (GRCm39) missense unknown
R8161:Chd7 UTSW 4 8,855,038 (GRCm39) missense probably damaging 1.00
R8274:Chd7 UTSW 4 8,839,432 (GRCm39) missense probably damaging 1.00
R8278:Chd7 UTSW 4 8,862,485 (GRCm39) splice site probably null
R8358:Chd7 UTSW 4 8,839,529 (GRCm39) missense probably damaging 1.00
R8464:Chd7 UTSW 4 8,811,465 (GRCm39) missense probably benign 0.06
R8483:Chd7 UTSW 4 8,822,412 (GRCm39) missense possibly damaging 0.65
R8507:Chd7 UTSW 4 8,858,675 (GRCm39) missense probably damaging 1.00
R8535:Chd7 UTSW 4 8,859,211 (GRCm39) missense possibly damaging 0.92
R8695:Chd7 UTSW 4 8,850,812 (GRCm39) missense probably damaging 1.00
R8700:Chd7 UTSW 4 8,833,892 (GRCm39) missense probably damaging 1.00
R8755:Chd7 UTSW 4 8,866,069 (GRCm39) missense probably benign 0.31
R8774:Chd7 UTSW 4 8,854,692 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Chd7 UTSW 4 8,854,692 (GRCm39) missense probably damaging 1.00
R8796:Chd7 UTSW 4 8,838,691 (GRCm39) missense probably damaging 1.00
R8992:Chd7 UTSW 4 8,839,589 (GRCm39) missense probably damaging 1.00
R9018:Chd7 UTSW 4 8,847,083 (GRCm39) missense possibly damaging 0.88
R9122:Chd7 UTSW 4 8,840,510 (GRCm39) missense possibly damaging 0.77
R9131:Chd7 UTSW 4 8,785,642 (GRCm39) missense
R9182:Chd7 UTSW 4 8,838,737 (GRCm39) missense probably damaging 1.00
R9227:Chd7 UTSW 4 8,805,272 (GRCm39) missense probably benign 0.03
R9254:Chd7 UTSW 4 8,752,210 (GRCm39) missense unknown
R9379:Chd7 UTSW 4 8,752,210 (GRCm39) missense unknown
R9388:Chd7 UTSW 4 8,865,756 (GRCm39) missense possibly damaging 0.89
R9455:Chd7 UTSW 4 8,752,061 (GRCm39) missense unknown
R9531:Chd7 UTSW 4 8,858,489 (GRCm39) missense
R9577:Chd7 UTSW 4 8,752,964 (GRCm39) missense unknown
R9634:Chd7 UTSW 4 8,832,499 (GRCm39) missense probably damaging 1.00
Z1176:Chd7 UTSW 4 8,844,313 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATCTGAGTATAGCGGGGTG -3'
(R):5'- TTGATCACTACTTCTCGGGGAC -3'

Sequencing Primer
(F):5'- TATAGCGGGGTGGCCTCTCTC -3'
(R):5'- AAGGTGGAGAACTCACTTTTGCC -3'
Posted On 2020-09-15