Incidental Mutation 'R7934:Eif2b3'
ID 648605
Institutional Source Beutler Lab
Gene Symbol Eif2b3
Ensembl Gene ENSMUSG00000028683
Gene Name eukaryotic translation initiation factor 2B, subunit 3
Synonyms 1190002P15Rik
MMRRC Submission 045980-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7934 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 116876559-116944049 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 116923675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 297 (Q297K)
Ref Sequence ENSEMBL: ENSMUSP00000102055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070610] [ENSMUST00000106447] [ENSMUST00000106448]
AlphaFold B1AUN2
Predicted Effect probably benign
Transcript: ENSMUST00000070610
AA Change: Q297K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070334
Gene: ENSMUSG00000028683
AA Change: Q297K

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 139 8.2e-20 PFAM
Pfam:NTP_transf_3 5 226 8.5e-19 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106447
AA Change: Q297K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102055
Gene: ENSMUSG00000028683
AA Change: Q297K

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 139 1.1e-19 PFAM
Pfam:NTP_transf_3 5 221 1.7e-18 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106448
AA Change: Q297K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102056
Gene: ENSMUSG00000028683
AA Change: Q297K

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 140 3.2e-19 PFAM
Pfam:NTP_transf_3 5 237 3.7e-18 PFAM
low complexity region 247 262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the subunits of initiation factor eIF2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. It has also been found to function as a cofactor of hepatitis C virus internal ribosome entry site-mediated translation. Mutations in this gene have been associated with leukodystrophy with vanishing white matter. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,349,770 (GRCm39) A93V probably benign Het
Abca8b G A 11: 109,865,865 (GRCm39) T296I possibly damaging Het
Adamtsl1 A C 4: 86,161,962 (GRCm39) Y365S probably damaging Het
Ambp T A 4: 63,067,677 (GRCm39) I178F probably damaging Het
Ankle1 T C 8: 71,858,899 (GRCm39) V44A possibly damaging Het
Arhgef2 A G 3: 88,537,221 (GRCm39) E37G probably damaging Het
Atp2a2 A G 5: 122,599,639 (GRCm39) I584T probably benign Het
Ccdc171 T A 4: 83,614,492 (GRCm39) L1031* probably null Het
Cdh17 T A 4: 11,799,754 (GRCm39) probably null Het
Cdip1 T C 16: 4,586,422 (GRCm39) T203A probably benign Het
Ceacam1 C T 7: 25,163,220 (GRCm39) V338I possibly damaging Het
Cep78 G A 19: 15,933,754 (GRCm39) T608I probably damaging Het
Ces3a T A 8: 105,775,345 (GRCm39) probably null Het
Cfap210 G A 2: 69,612,450 (GRCm39) Q97* probably null Het
Chd7 A G 4: 8,854,121 (GRCm39) T1898A probably benign Het
Cpne6 T C 14: 55,750,066 (GRCm39) C66R possibly damaging Het
Creb1 G A 1: 64,609,372 (GRCm39) A108T probably benign Het
Ctnna3 A T 10: 64,421,747 (GRCm39) I514F probably damaging Het
Cyp2c55 T C 19: 39,030,535 (GRCm39) F456L probably damaging Het
Cyp2d40 A G 15: 82,648,212 (GRCm39) S34P probably damaging Het
Cyp2g1 A T 7: 26,518,618 (GRCm39) T378S probably damaging Het
Fbll1 T C 11: 35,689,048 (GRCm39) N72D unknown Het
Fev C G 1: 74,921,632 (GRCm39) R106P probably damaging Het
Gal3st1 A G 11: 3,948,405 (GRCm39) Y204C probably damaging Het
Gm15130 A T 2: 110,964,582 (GRCm39) L180Q Het
Greb1l A T 18: 10,474,371 (GRCm39) K229* probably null Het
Haghl G T 17: 26,002,519 (GRCm39) T214K probably damaging Het
Hivep1 A G 13: 42,308,174 (GRCm39) H138R probably benign Het
Ighv1-53 G T 12: 115,122,236 (GRCm39) Y46* probably null Het
Igsf21 T C 4: 139,761,755 (GRCm39) T308A possibly damaging Het
Kcnb1 A G 2: 166,946,536 (GRCm39) S771P probably benign Het
Kndc1 T A 7: 139,501,402 (GRCm39) M897K probably benign Het
Macf1 T C 4: 123,367,727 (GRCm39) M2345V possibly damaging Het
Mettl2 T C 11: 105,019,773 (GRCm39) S137P probably benign Het
Mrpl15 A G 1: 4,844,725 (GRCm39) S189P probably benign Het
Ndrg2 T C 14: 52,143,661 (GRCm39) Q351R probably benign Het
Nox4 A G 7: 86,945,032 (GRCm39) N65S probably damaging Het
Or1n1 A G 2: 36,750,228 (GRCm39) I44T possibly damaging Het
Or1p1b C T 11: 74,131,326 (GRCm39) S312F probably benign Het
Osbpl11 T A 16: 33,056,752 (GRCm39) W729R probably damaging Het
Oxct2b C A 4: 123,010,447 (GRCm39) C122* probably null Het
Pdcl3 A T 1: 39,026,782 (GRCm39) probably benign Het
Plcg1 A G 2: 160,616,498 (GRCm39) H1294R possibly damaging Het
Pnp2 C A 14: 51,201,903 (GRCm39) S296R probably benign Het
Ppp1r12c G A 7: 4,488,416 (GRCm39) Q337* probably null Het
Prr23a4 A G 9: 98,785,880 (GRCm39) R182G possibly damaging Het
Ranbp2 G A 10: 58,312,297 (GRCm39) V1006I probably damaging Het
Rxrg A G 1: 167,454,927 (GRCm39) D170G probably damaging Het
Sf3b3 T C 8: 111,548,162 (GRCm39) T691A probably benign Het
Slc1a4 A G 11: 20,258,518 (GRCm39) I307T probably damaging Het
Slc4a8 G A 15: 100,685,173 (GRCm39) V235I probably damaging Het
Srgap3 T A 6: 112,708,450 (GRCm39) I750F probably damaging Het
Trim30a A T 7: 104,061,448 (GRCm39) L282Q probably damaging Het
Tshr A G 12: 91,478,702 (GRCm39) K183R possibly damaging Het
Usp38 A T 8: 81,711,077 (GRCm39) L986Q probably damaging Het
Vmn1r257 T A 7: 22,391,439 (GRCm39) T102S possibly damaging Het
Vps18 A G 2: 119,124,122 (GRCm39) T350A probably benign Het
Zan T A 5: 137,461,841 (GRCm39) T1113S unknown Het
Zbtb37 A T 1: 160,857,305 (GRCm39) S312R probably damaging Het
Zeb1 A G 18: 5,748,703 (GRCm39) N90S probably benign Het
Zfp715 A T 7: 42,949,308 (GRCm39) Y217* probably null Het
Zfp9 T C 6: 118,441,847 (GRCm39) T272A probably damaging Het
Zfp943 T A 17: 22,212,361 (GRCm39) H482Q probably damaging Het
Zfp971 A T 2: 177,675,173 (GRCm39) K257N probably benign Het
Other mutations in Eif2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Eif2b3 APN 4 116,923,666 (GRCm39) missense probably benign
IGL01333:Eif2b3 APN 4 116,927,887 (GRCm39) missense probably benign 0.31
IGL01564:Eif2b3 APN 4 116,885,739 (GRCm39) missense probably benign 0.00
IGL01721:Eif2b3 APN 4 116,916,001 (GRCm39) missense probably damaging 1.00
IGL02061:Eif2b3 APN 4 116,885,608 (GRCm39) missense possibly damaging 0.78
Cambio UTSW 4 116,923,578 (GRCm39) nonsense probably null
mogrify UTSW 4 116,885,622 (GRCm39) missense possibly damaging 0.66
R0835:Eif2b3 UTSW 4 116,916,002 (GRCm39) missense probably damaging 1.00
R0924:Eif2b3 UTSW 4 116,938,775 (GRCm39) missense possibly damaging 0.93
R2167:Eif2b3 UTSW 4 116,885,737 (GRCm39) missense probably damaging 1.00
R2424:Eif2b3 UTSW 4 116,928,045 (GRCm39) missense probably benign 0.01
R3902:Eif2b3 UTSW 4 116,879,404 (GRCm39) missense probably damaging 1.00
R4105:Eif2b3 UTSW 4 116,938,831 (GRCm39) missense probably damaging 1.00
R4688:Eif2b3 UTSW 4 116,916,046 (GRCm39) missense probably benign 0.03
R4998:Eif2b3 UTSW 4 116,923,589 (GRCm39) missense probably benign 0.06
R5033:Eif2b3 UTSW 4 116,909,933 (GRCm39) missense probably damaging 1.00
R5123:Eif2b3 UTSW 4 116,879,408 (GRCm39) missense probably damaging 1.00
R5493:Eif2b3 UTSW 4 116,943,919 (GRCm39) missense possibly damaging 0.92
R5787:Eif2b3 UTSW 4 116,901,637 (GRCm39) missense probably damaging 1.00
R5789:Eif2b3 UTSW 4 116,885,692 (GRCm39) missense probably damaging 1.00
R6347:Eif2b3 UTSW 4 116,901,763 (GRCm39) missense probably benign 0.05
R6361:Eif2b3 UTSW 4 116,885,622 (GRCm39) missense possibly damaging 0.66
R6643:Eif2b3 UTSW 4 116,927,954 (GRCm39) missense probably damaging 0.97
R6798:Eif2b3 UTSW 4 116,923,655 (GRCm39) missense probably benign 0.00
R7299:Eif2b3 UTSW 4 116,910,019 (GRCm39) missense probably benign 0.27
R7301:Eif2b3 UTSW 4 116,910,019 (GRCm39) missense probably benign 0.27
R7451:Eif2b3 UTSW 4 116,909,993 (GRCm39) nonsense probably null
R8117:Eif2b3 UTSW 4 116,879,414 (GRCm39) missense probably damaging 0.98
R8725:Eif2b3 UTSW 4 116,927,944 (GRCm39) missense probably benign 0.01
R8727:Eif2b3 UTSW 4 116,927,944 (GRCm39) missense probably benign 0.01
R8816:Eif2b3 UTSW 4 116,928,052 (GRCm39) missense probably benign
R8943:Eif2b3 UTSW 4 116,901,778 (GRCm39) missense probably damaging 0.99
R9141:Eif2b3 UTSW 4 116,923,578 (GRCm39) nonsense probably null
R9426:Eif2b3 UTSW 4 116,923,578 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAAAACCTAATTCAATCTGTGTCTCC -3'
(R):5'- CACTGAGTTCCTGTCTTTGAAGTC -3'

Sequencing Primer
(F):5'- AATTCAATCTGTGTCTCCTATACACC -3'
(R):5'- CTTGCTCAGCTTCAGAAGTGTAGAC -3'
Posted On 2020-09-15