Incidental Mutation 'R7934:Eif2b3'
ID 648605
Institutional Source Beutler Lab
Gene Symbol Eif2b3
Ensembl Gene ENSMUSG00000028683
Gene Name eukaryotic translation initiation factor 2B, subunit 3
Synonyms 1190002P15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7934 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 117019402-117087306 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 117066478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 297 (Q297K)
Ref Sequence ENSEMBL: ENSMUSP00000102055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070610] [ENSMUST00000106447] [ENSMUST00000106448]
AlphaFold B1AUN2
Predicted Effect probably benign
Transcript: ENSMUST00000070610
AA Change: Q297K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070334
Gene: ENSMUSG00000028683
AA Change: Q297K

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 139 8.2e-20 PFAM
Pfam:NTP_transf_3 5 226 8.5e-19 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106447
AA Change: Q297K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102055
Gene: ENSMUSG00000028683
AA Change: Q297K

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 139 1.1e-19 PFAM
Pfam:NTP_transf_3 5 221 1.7e-18 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106448
AA Change: Q297K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102056
Gene: ENSMUSG00000028683
AA Change: Q297K

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 140 3.2e-19 PFAM
Pfam:NTP_transf_3 5 237 3.7e-18 PFAM
low complexity region 247 262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the subunits of initiation factor eIF2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. It has also been found to function as a cofactor of hepatitis C virus internal ribosome entry site-mediated translation. Mutations in this gene have been associated with leukodystrophy with vanishing white matter. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,015 A93V probably benign Het
7420426K07Rik A G 9: 98,903,827 R182G possibly damaging Het
Abca8b G A 11: 109,975,039 T296I possibly damaging Het
Adamtsl1 A C 4: 86,243,725 Y365S probably damaging Het
Ambp T A 4: 63,149,440 I178F probably damaging Het
Ankle1 T C 8: 71,406,255 V44A possibly damaging Het
Arhgef2 A G 3: 88,629,914 E37G probably damaging Het
Atp2a2 A G 5: 122,461,576 I584T probably benign Het
Ccdc171 T A 4: 83,696,255 L1031* probably null Het
Ccdc173 G A 2: 69,782,106 Q97* probably null Het
Cdh17 T A 4: 11,799,754 probably null Het
Cdip1 T C 16: 4,768,558 T203A probably benign Het
Ceacam1 C T 7: 25,463,795 V338I possibly damaging Het
Cep78 G A 19: 15,956,390 T608I probably damaging Het
Ces3a T A 8: 105,048,713 probably null Het
Chd7 A G 4: 8,854,121 T1898A probably benign Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Creb1 G A 1: 64,570,213 A108T probably benign Het
Ctnna3 A T 10: 64,585,968 I514F probably damaging Het
Cyp2c55 T C 19: 39,042,091 F456L probably damaging Het
Cyp2d40 A G 15: 82,764,011 S34P probably damaging Het
Cyp2g1 A T 7: 26,819,193 T378S probably damaging Het
Fbll1 T C 11: 35,798,221 N72D unknown Het
Fev C G 1: 74,882,473 R106P probably damaging Het
Gal3st1 A G 11: 3,998,405 Y204C probably damaging Het
Gm15130 A T 2: 111,134,237 L180Q Het
Gm8693 T A 7: 22,692,014 T102S possibly damaging Het
Greb1l A T 18: 10,474,371 K229* probably null Het
Haghl G T 17: 25,783,545 T214K probably damaging Het
Hivep1 A G 13: 42,154,698 H138R probably benign Het
Ighv1-53 G T 12: 115,158,616 Y46* probably null Het
Igsf21 T C 4: 140,034,444 T308A possibly damaging Het
Kcnb1 A G 2: 167,104,616 S771P probably benign Het
Kndc1 T A 7: 139,921,486 M897K probably benign Het
Macf1 T C 4: 123,473,934 M2345V possibly damaging Het
Mettl2 T C 11: 105,128,947 S137P probably benign Het
Mrpl15 A G 1: 4,774,502 S189P probably benign Het
Ndrg2 T C 14: 51,906,204 Q351R probably benign Het
Nox4 A G 7: 87,295,824 N65S probably damaging Het
Olfr351 A G 2: 36,860,216 I44T possibly damaging Het
Olfr404-ps1 C T 11: 74,240,500 S312F probably benign Het
Osbpl11 T A 16: 33,236,382 W729R probably damaging Het
Oxct2b C A 4: 123,116,654 C122* probably null Het
Pdcl3 A T 1: 38,987,701 probably benign Het
Plcg1 A G 2: 160,774,578 H1294R possibly damaging Het
Pnp2 C A 14: 50,964,446 S296R probably benign Het
Ppp1r12c G A 7: 4,485,417 Q337* probably null Het
Ranbp2 G A 10: 58,476,475 V1006I probably damaging Het
Rxrg A G 1: 167,627,358 D170G probably damaging Het
Sf3b3 T C 8: 110,821,530 T691A probably benign Het
Slc1a4 A G 11: 20,308,518 I307T probably damaging Het
Slc4a8 G A 15: 100,787,292 V235I probably damaging Het
Srgap3 T A 6: 112,731,489 I750F probably damaging Het
Trim30a A T 7: 104,412,241 L282Q probably damaging Het
Tshr A G 12: 91,511,928 K183R possibly damaging Het
Usp38 A T 8: 80,984,448 L986Q probably damaging Het
Vps18 A G 2: 119,293,641 T350A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zbtb37 A T 1: 161,029,735 S312R probably damaging Het
Zeb1 A G 18: 5,748,703 N90S probably benign Het
Zfp715 A T 7: 43,299,884 Y217* probably null Het
Zfp9 T C 6: 118,464,886 T272A probably damaging Het
Zfp943 T A 17: 21,993,380 H482Q probably damaging Het
Zfp971 A T 2: 178,033,380 K257N probably benign Het
Other mutations in Eif2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Eif2b3 APN 4 117066469 missense probably benign
IGL01333:Eif2b3 APN 4 117070690 missense probably benign 0.31
IGL01564:Eif2b3 APN 4 117028542 missense probably benign 0.00
IGL01721:Eif2b3 APN 4 117058804 missense probably damaging 1.00
IGL02061:Eif2b3 APN 4 117028411 missense possibly damaging 0.78
Cambio UTSW 4 117066381 nonsense probably null
mogrify UTSW 4 117028425 missense possibly damaging 0.66
R0835:Eif2b3 UTSW 4 117058805 missense probably damaging 1.00
R0924:Eif2b3 UTSW 4 117081578 missense possibly damaging 0.93
R2167:Eif2b3 UTSW 4 117028540 missense probably damaging 1.00
R2424:Eif2b3 UTSW 4 117070848 missense probably benign 0.01
R3902:Eif2b3 UTSW 4 117022207 missense probably damaging 1.00
R4105:Eif2b3 UTSW 4 117081634 missense probably damaging 1.00
R4688:Eif2b3 UTSW 4 117058849 missense probably benign 0.03
R4998:Eif2b3 UTSW 4 117066392 missense probably benign 0.06
R5033:Eif2b3 UTSW 4 117052736 missense probably damaging 1.00
R5123:Eif2b3 UTSW 4 117022211 missense probably damaging 1.00
R5493:Eif2b3 UTSW 4 117086722 missense possibly damaging 0.92
R5787:Eif2b3 UTSW 4 117044440 missense probably damaging 1.00
R5789:Eif2b3 UTSW 4 117028495 missense probably damaging 1.00
R6347:Eif2b3 UTSW 4 117044566 missense probably benign 0.05
R6361:Eif2b3 UTSW 4 117028425 missense possibly damaging 0.66
R6643:Eif2b3 UTSW 4 117070757 missense probably damaging 0.97
R6798:Eif2b3 UTSW 4 117066458 missense probably benign 0.00
R7299:Eif2b3 UTSW 4 117052822 missense probably benign 0.27
R7301:Eif2b3 UTSW 4 117052822 missense probably benign 0.27
R7451:Eif2b3 UTSW 4 117052796 nonsense probably null
R8117:Eif2b3 UTSW 4 117022217 missense probably damaging 0.98
R8725:Eif2b3 UTSW 4 117070747 missense probably benign 0.01
R8727:Eif2b3 UTSW 4 117070747 missense probably benign 0.01
R8816:Eif2b3 UTSW 4 117070855 missense probably benign
R8943:Eif2b3 UTSW 4 117044581 missense probably damaging 0.99
R9141:Eif2b3 UTSW 4 117066381 nonsense probably null
R9426:Eif2b3 UTSW 4 117066381 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAAAACCTAATTCAATCTGTGTCTCC -3'
(R):5'- CACTGAGTTCCTGTCTTTGAAGTC -3'

Sequencing Primer
(F):5'- AATTCAATCTGTGTCTCCTATACACC -3'
(R):5'- CTTGCTCAGCTTCAGAAGTGTAGAC -3'
Posted On 2020-09-15