Incidental Mutation 'R7934:Srgap3'
ID 648612
Institutional Source Beutler Lab
Gene Symbol Srgap3
Ensembl Gene ENSMUSG00000030257
Gene Name SLIT-ROBO Rho GTPase activating protein 3
Synonyms Arhgap14, D130026O08Rik
MMRRC Submission 045980-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.246) question?
Stock # R7934 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 112694932-112924227 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 112708450 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 750 (I750F)
Ref Sequence ENSEMBL: ENSMUSP00000085712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088373] [ENSMUST00000113169]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000088373
AA Change: I750F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085712
Gene: ENSMUSG00000030257
AA Change: I750F

DomainStartEndE-ValueType
FCH 22 120 3.81e-16 SMART
low complexity region 172 190 N/A INTRINSIC
coiled coil region 353 392 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
RhoGAP 517 691 7.43e-66 SMART
SH3 747 802 9.69e-15 SMART
coiled coil region 955 985 N/A INTRINSIC
low complexity region 1025 1038 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113169
AA Change: I726F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108794
Gene: ENSMUSG00000030257
AA Change: I726F

DomainStartEndE-ValueType
FCH 22 120 3.81e-16 SMART
low complexity region 172 190 N/A INTRINSIC
coiled coil region 353 392 N/A INTRINSIC
Blast:RhoGAP 434 474 4e-11 BLAST
low complexity region 476 488 N/A INTRINSIC
RhoGAP 493 667 7.43e-66 SMART
SH3 723 778 9.69e-15 SMART
coiled coil region 931 961 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in spine density in the brain CA1 and cortical layers IV/V. Mice homozygous for a different knock-out allele exhibit a neurodevelopment disorder with schizophrenia-related intermediate phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,349,770 (GRCm39) A93V probably benign Het
Abca8b G A 11: 109,865,865 (GRCm39) T296I possibly damaging Het
Adamtsl1 A C 4: 86,161,962 (GRCm39) Y365S probably damaging Het
Ambp T A 4: 63,067,677 (GRCm39) I178F probably damaging Het
Ankle1 T C 8: 71,858,899 (GRCm39) V44A possibly damaging Het
Arhgef2 A G 3: 88,537,221 (GRCm39) E37G probably damaging Het
Atp2a2 A G 5: 122,599,639 (GRCm39) I584T probably benign Het
Ccdc171 T A 4: 83,614,492 (GRCm39) L1031* probably null Het
Cdh17 T A 4: 11,799,754 (GRCm39) probably null Het
Cdip1 T C 16: 4,586,422 (GRCm39) T203A probably benign Het
Ceacam1 C T 7: 25,163,220 (GRCm39) V338I possibly damaging Het
Cep78 G A 19: 15,933,754 (GRCm39) T608I probably damaging Het
Ces3a T A 8: 105,775,345 (GRCm39) probably null Het
Cfap210 G A 2: 69,612,450 (GRCm39) Q97* probably null Het
Chd7 A G 4: 8,854,121 (GRCm39) T1898A probably benign Het
Cpne6 T C 14: 55,750,066 (GRCm39) C66R possibly damaging Het
Creb1 G A 1: 64,609,372 (GRCm39) A108T probably benign Het
Ctnna3 A T 10: 64,421,747 (GRCm39) I514F probably damaging Het
Cyp2c55 T C 19: 39,030,535 (GRCm39) F456L probably damaging Het
Cyp2d40 A G 15: 82,648,212 (GRCm39) S34P probably damaging Het
Cyp2g1 A T 7: 26,518,618 (GRCm39) T378S probably damaging Het
Eif2b3 C A 4: 116,923,675 (GRCm39) Q297K probably benign Het
Fbll1 T C 11: 35,689,048 (GRCm39) N72D unknown Het
Fev C G 1: 74,921,632 (GRCm39) R106P probably damaging Het
Gal3st1 A G 11: 3,948,405 (GRCm39) Y204C probably damaging Het
Gm15130 A T 2: 110,964,582 (GRCm39) L180Q Het
Greb1l A T 18: 10,474,371 (GRCm39) K229* probably null Het
Haghl G T 17: 26,002,519 (GRCm39) T214K probably damaging Het
Hivep1 A G 13: 42,308,174 (GRCm39) H138R probably benign Het
Ighv1-53 G T 12: 115,122,236 (GRCm39) Y46* probably null Het
Igsf21 T C 4: 139,761,755 (GRCm39) T308A possibly damaging Het
Kcnb1 A G 2: 166,946,536 (GRCm39) S771P probably benign Het
Kndc1 T A 7: 139,501,402 (GRCm39) M897K probably benign Het
Macf1 T C 4: 123,367,727 (GRCm39) M2345V possibly damaging Het
Mettl2 T C 11: 105,019,773 (GRCm39) S137P probably benign Het
Mrpl15 A G 1: 4,844,725 (GRCm39) S189P probably benign Het
Ndrg2 T C 14: 52,143,661 (GRCm39) Q351R probably benign Het
Nox4 A G 7: 86,945,032 (GRCm39) N65S probably damaging Het
Or1n1 A G 2: 36,750,228 (GRCm39) I44T possibly damaging Het
Or1p1b C T 11: 74,131,326 (GRCm39) S312F probably benign Het
Osbpl11 T A 16: 33,056,752 (GRCm39) W729R probably damaging Het
Oxct2b C A 4: 123,010,447 (GRCm39) C122* probably null Het
Pdcl3 A T 1: 39,026,782 (GRCm39) probably benign Het
Plcg1 A G 2: 160,616,498 (GRCm39) H1294R possibly damaging Het
Pnp2 C A 14: 51,201,903 (GRCm39) S296R probably benign Het
Ppp1r12c G A 7: 4,488,416 (GRCm39) Q337* probably null Het
Prr23a4 A G 9: 98,785,880 (GRCm39) R182G possibly damaging Het
Ranbp2 G A 10: 58,312,297 (GRCm39) V1006I probably damaging Het
Rxrg A G 1: 167,454,927 (GRCm39) D170G probably damaging Het
Sf3b3 T C 8: 111,548,162 (GRCm39) T691A probably benign Het
Slc1a4 A G 11: 20,258,518 (GRCm39) I307T probably damaging Het
Slc4a8 G A 15: 100,685,173 (GRCm39) V235I probably damaging Het
Trim30a A T 7: 104,061,448 (GRCm39) L282Q probably damaging Het
Tshr A G 12: 91,478,702 (GRCm39) K183R possibly damaging Het
Usp38 A T 8: 81,711,077 (GRCm39) L986Q probably damaging Het
Vmn1r257 T A 7: 22,391,439 (GRCm39) T102S possibly damaging Het
Vps18 A G 2: 119,124,122 (GRCm39) T350A probably benign Het
Zan T A 5: 137,461,841 (GRCm39) T1113S unknown Het
Zbtb37 A T 1: 160,857,305 (GRCm39) S312R probably damaging Het
Zeb1 A G 18: 5,748,703 (GRCm39) N90S probably benign Het
Zfp715 A T 7: 42,949,308 (GRCm39) Y217* probably null Het
Zfp9 T C 6: 118,441,847 (GRCm39) T272A probably damaging Het
Zfp943 T A 17: 22,212,361 (GRCm39) H482Q probably damaging Het
Zfp971 A T 2: 177,675,173 (GRCm39) K257N probably benign Het
Other mutations in Srgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Srgap3 APN 6 112,716,358 (GRCm39) missense probably damaging 0.98
IGL01325:Srgap3 APN 6 112,752,647 (GRCm39) missense probably damaging 1.00
IGL01608:Srgap3 APN 6 112,923,439 (GRCm39) missense probably benign 0.00
IGL01626:Srgap3 APN 6 112,750,609 (GRCm39) missense probably damaging 0.98
IGL01787:Srgap3 APN 6 112,699,983 (GRCm39) missense probably benign 0.00
IGL02698:Srgap3 APN 6 112,723,889 (GRCm39) missense probably damaging 0.98
IGL02805:Srgap3 APN 6 112,704,224 (GRCm39) missense probably damaging 0.99
IGL02813:Srgap3 APN 6 112,708,441 (GRCm39) missense probably damaging 1.00
IGL02876:Srgap3 APN 6 112,748,414 (GRCm39) missense probably damaging 1.00
IGL03264:Srgap3 APN 6 112,793,636 (GRCm39) missense probably damaging 1.00
IGL03342:Srgap3 APN 6 112,752,648 (GRCm39) missense probably damaging 1.00
R0007:Srgap3 UTSW 6 112,806,473 (GRCm39) missense probably damaging 1.00
R0371:Srgap3 UTSW 6 112,748,432 (GRCm39) missense probably damaging 0.99
R0607:Srgap3 UTSW 6 112,700,080 (GRCm39) missense probably damaging 1.00
R1628:Srgap3 UTSW 6 112,716,331 (GRCm39) missense probably damaging 0.99
R1669:Srgap3 UTSW 6 112,699,865 (GRCm39) missense probably benign 0.36
R1858:Srgap3 UTSW 6 112,748,479 (GRCm39) missense probably damaging 1.00
R1876:Srgap3 UTSW 6 112,752,527 (GRCm39) missense probably damaging 0.98
R1896:Srgap3 UTSW 6 112,715,958 (GRCm39) missense probably benign 0.11
R2159:Srgap3 UTSW 6 112,748,339 (GRCm39) missense probably damaging 0.99
R2221:Srgap3 UTSW 6 112,923,454 (GRCm39) missense probably damaging 0.98
R2862:Srgap3 UTSW 6 112,699,933 (GRCm39) missense probably damaging 0.99
R3160:Srgap3 UTSW 6 112,706,619 (GRCm39) missense probably benign 0.00
R3162:Srgap3 UTSW 6 112,706,619 (GRCm39) missense probably benign 0.00
R4092:Srgap3 UTSW 6 112,700,045 (GRCm39) missense probably benign 0.00
R4561:Srgap3 UTSW 6 112,758,015 (GRCm39) missense probably damaging 0.98
R4781:Srgap3 UTSW 6 112,734,386 (GRCm39) intron probably benign
R4825:Srgap3 UTSW 6 112,704,271 (GRCm39) missense probably benign
R4887:Srgap3 UTSW 6 112,723,895 (GRCm39) missense probably damaging 1.00
R5304:Srgap3 UTSW 6 112,743,900 (GRCm39) missense probably damaging 1.00
R5556:Srgap3 UTSW 6 112,716,039 (GRCm39) missense probably damaging 0.99
R5672:Srgap3 UTSW 6 112,752,522 (GRCm39) missense probably benign
R5879:Srgap3 UTSW 6 112,699,807 (GRCm39) missense possibly damaging 0.67
R5944:Srgap3 UTSW 6 112,772,775 (GRCm39) missense possibly damaging 0.89
R6277:Srgap3 UTSW 6 112,716,344 (GRCm39) missense probably benign 0.02
R6298:Srgap3 UTSW 6 112,793,571 (GRCm39) missense probably damaging 0.98
R6407:Srgap3 UTSW 6 112,699,967 (GRCm39) missense probably damaging 0.99
R6408:Srgap3 UTSW 6 112,699,967 (GRCm39) missense probably damaging 0.99
R6797:Srgap3 UTSW 6 112,806,503 (GRCm39) missense probably damaging 1.00
R6852:Srgap3 UTSW 6 112,793,622 (GRCm39) missense probably damaging 1.00
R6965:Srgap3 UTSW 6 112,700,090 (GRCm39) missense probably damaging 1.00
R7055:Srgap3 UTSW 6 112,723,924 (GRCm39) missense probably damaging 0.97
R7067:Srgap3 UTSW 6 112,734,266 (GRCm39) intron probably benign
R7361:Srgap3 UTSW 6 112,723,882 (GRCm39) missense probably damaging 0.99
R7479:Srgap3 UTSW 6 112,712,794 (GRCm39) critical splice donor site probably null
R7606:Srgap3 UTSW 6 112,716,337 (GRCm39) missense probably benign 0.00
R7731:Srgap3 UTSW 6 112,743,858 (GRCm39) missense probably benign 0.36
R7787:Srgap3 UTSW 6 112,752,520 (GRCm39) missense probably benign 0.02
R8026:Srgap3 UTSW 6 112,716,325 (GRCm39) missense probably benign 0.00
R8040:Srgap3 UTSW 6 112,716,325 (GRCm39) missense probably benign 0.00
R8066:Srgap3 UTSW 6 112,748,339 (GRCm39) missense probably damaging 0.99
R8067:Srgap3 UTSW 6 112,716,325 (GRCm39) missense probably benign 0.00
R8090:Srgap3 UTSW 6 112,757,996 (GRCm39) nonsense probably null
R8151:Srgap3 UTSW 6 112,793,628 (GRCm39) missense probably damaging 1.00
R8248:Srgap3 UTSW 6 112,700,104 (GRCm39) missense probably damaging 1.00
R8365:Srgap3 UTSW 6 112,793,695 (GRCm39) missense probably damaging 1.00
R8369:Srgap3 UTSW 6 112,699,779 (GRCm39) missense probably benign
R8444:Srgap3 UTSW 6 112,752,509 (GRCm39) missense possibly damaging 0.56
R8509:Srgap3 UTSW 6 112,708,297 (GRCm39) nonsense probably null
R8772:Srgap3 UTSW 6 112,743,906 (GRCm39) missense probably damaging 1.00
R8827:Srgap3 UTSW 6 112,716,302 (GRCm39) missense probably damaging 1.00
R8881:Srgap3 UTSW 6 112,700,098 (GRCm39) missense probably benign
R9002:Srgap3 UTSW 6 112,757,854 (GRCm39) missense possibly damaging 0.76
R9041:Srgap3 UTSW 6 112,754,054 (GRCm39) missense probably damaging 0.99
R9198:Srgap3 UTSW 6 112,743,865 (GRCm39) missense probably damaging 1.00
R9404:Srgap3 UTSW 6 112,706,616 (GRCm39) missense probably benign 0.04
R9616:Srgap3 UTSW 6 112,748,524 (GRCm39) missense probably damaging 1.00
X0062:Srgap3 UTSW 6 112,772,747 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATTCTTCACAGAAGGCCC -3'
(R):5'- CATTCTGAGAAATTGCATGGCTTG -3'

Sequencing Primer
(F):5'- ATTCTTCACAGAAGGCCCCAGTTC -3'
(R):5'- CTTGCCTAAGATCAAGGAGTCTG -3'
Posted On 2020-09-15